10-86756637-CGGCGGCCGCTGCAGAGATTGGAATCCGCCTGCCGGGCTTGGCGAAGGAGAAGGGAGGAGGCAGGAGCGAGGAGGGAGGAGGGCCAAGGGCGGGCAGGAAGGCTTAGGCTCGGCGCGTCCGTCCGCGCGCGGCGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACGCCAAGGGCGAAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGCTCCGCGCCGAGGGCTGGAGGATGCGTTCCCTGGGGTCCG-C
- chr10-86756637-CGGCGGCCGCTGCAGAGATTGGAATCCGCCTGCCGGGCTTGGCGAAGGAGAAGGGAGGAGGCAGGAGCGAGGAGGGAGGAGGGCCAAGGGCGGGCAGGAAGGCTTAGGCTCGGCGCGTCCGTCCGCGCGCGGCGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACGCCAAGGGCGAAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGCTCCGCGCCGAGGGCTGGAGGATGCGTTCCCTGGGGTCCG-C
- rs1564673999
- NM_004329.3:c.-547_-268+1del
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_004329.3(BMPR1A):c.-547_-268+1del variant causes a splice donor, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_004329.3 splice_donor, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
BMPR1A | NM_004329.3 | c.-547_-268+1del | splice_region_variant | Exon 1 of 13 | ENST00000372037.8 | NP_004320.2 | ||
BMPR1A | NM_004329.3 | c.-547_-268+1del | splice_donor_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 13 | ENST00000372037.8 | NP_004320.2 | ||
BMPR1A | NM_004329.3 | c.-547_-268+1del | non_coding_transcript_variant | ENST00000372037.8 | NP_004320.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
BMPR1A | ENST00000372037.8 | c.-548_-268del | splice_region_variant | Exon 1 of 13 | 1 | NM_004329.3 | ENSP00000361107.2 | |||
BMPR1A | ENST00000372037 | c.-548_-268del | 5_prime_UTR_variant | Exon 1 of 13 | 1 | NM_004329.3 | ENSP00000361107.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Generalized juvenile polyposis/juvenile polyposis coli Pathogenic:1
This variant is a gross deletion of the genomic region encompassing the promoter (non-coding exon 1) of the BMPR1A gene. The 5' end of this event is unknown as it extends beyond the assayed region for this gene, and therefore may encompass additional genes. The 3' boundary is likely confined to the region between non-coding exon 1 and non-coding exon 2. A large genomic deletion involving the promoter region (non-coding exon 1) has been reported to segregate with BMPR1A-related disease in a family (PMID: 20843829). A similar deletion involving the promoter region has also been reported in an individual with congenital heart defect who was pending for juvenile polyposis screening (PMID: 22067610). Experimental studies have shown that deletion of this promoter region impairs the transcription of a reporter gene in vitro, and protein samples derived from individuals carrying this variant showed reduced BMPR1A protein levels compared to a control sample (PMID: 20843829, 21872883). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at