10-88935184-CAGTTGTGTGCTAGAGACAGAGAGGAGCAGGAAA-C
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_001613.4(ACTA2):c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Genomes: not found (cov: 32)
Consequence
ACTA2
NM_001613.4 3_prime_UTR
NM_001613.4 3_prime_UTR
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 2.96
Genes affected
ACTA2 (HGNC:130): (actin alpha 2, smooth muscle) This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a smooth muscle actin that is involved in vascular contractility and blood pressure homeostasis. Mutations in this gene cause a variety of vascular diseases, such as thoracic aortic disease, coronary artery disease, stroke, and Moyamoya disease, as well as multisystemic smooth muscle dysfunction syndrome. [provided by RefSeq, Sep 2017]
STAMBPL1 (HGNC:24105): (STAM binding protein like 1) Predicted to enable Lys63-specific deubiquitinase activity and thiol-dependent deubiquitinase. Predicted to be involved in protein K63-linked deubiquitination. Located in membrane. [provided by Alliance of Genome Resources, Apr 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Familial thoracic aortic aneurysm and aortic dissection Uncertain:2
Uncertain significance, criteria provided, single submitter | clinical testing | All of Us Research Program, National Institutes of Health | Jun 26, 2023 | This variant is located in the 3' untranslated region of the ACTA2 gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with ACTA2-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. - |
Uncertain significance, criteria provided, single submitter | clinical testing | Color Diagnostics, LLC DBA Color Health | May 31, 2023 | This variant is located in the 3' untranslated region of the ACTA2 gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with ACTA2-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at