10-88935184-CAGTTGTGTGCTAGAGACAGAGAGGAGCAGGAAA-C

Variant names:

• chr10-88935184-CAGTTGTGTGCTAGAGACAGAGAGGAGCAGGAAA-C
• rs1845709130
• NM_001613.4:c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001613.4(ACTA2):​c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACTA2 NM_001613.4 3_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 2.96
• Publications: 0 publications found

Genes affected

ACTA2 (HGNC:130): (actin alpha 2, smooth muscle) This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a smooth muscle actin that is involved in vascular contractility and blood pressure homeostasis. Mutations in this gene cause a variety of vascular diseases, such as thoracic aortic disease, coronary artery disease, stroke, and Moyamoya disease, as well as multisystemic smooth muscle dysfunction syndrome. [provided by RefSeq, Sep 2017]

STAMBPL1 (HGNC:24105): (STAM binding protein like 1) Predicted to enable Lys63-specific deubiquitinase activity and thiol-dependent deubiquitinase. Predicted to be involved in protein K63-linked deubiquitination. Located in membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACTA2-AS1 (HGNC:45169): (ACTA2 antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001613.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACTA2	NM_001613.4	MANE Select	c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT		3_prime_UTR	Exon 9 of 9	NP_001604.1	P62736
	ACTA2	NM_001141945.3		c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT		3_prime_UTR	Exon 9 of 9	NP_001135417.1	D2JYH4
	ACTA2	NM_001320855.2		c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT		3_prime_UTR	Exon 9 of 9	NP_001307784.1	P62736

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACTA2	ENST00000224784.10	TSL:1 MANE Select	c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT		3_prime_UTR	Exon 9 of 9	ENSP00000224784.6	P62736
	ACTA2	ENST00000713598.1		c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT		3_prime_UTR	Exon 9 of 9	ENSP00000518894.1	A0AAQ5BGG5
	ACTA2	ENST00000415557.2	TSL:3	c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT		3_prime_UTR	Exon 9 of 9	ENSP00000396730.2	P62736

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	Familial thoracic aortic aneurysm and aortic dissection (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1845709130; hg19: chr10-90694941;