chr10-88935184-CAGTTGTGTGCTAGAGACAGAGAGGAGCAGGAAA-C

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001613.4(ACTA2):​c.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

ACTA2
NM_001613.4 3_prime_UTR

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:2

Conservation

PhyloP100: 2.96
Variant links:
Genes affected
ACTA2 (HGNC:130): (actin alpha 2, smooth muscle) This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a smooth muscle actin that is involved in vascular contractility and blood pressure homeostasis. Mutations in this gene cause a variety of vascular diseases, such as thoracic aortic disease, coronary artery disease, stroke, and Moyamoya disease, as well as multisystemic smooth muscle dysfunction syndrome. [provided by RefSeq, Sep 2017]
STAMBPL1 (HGNC:24105): (STAM binding protein like 1) Predicted to enable Lys63-specific deubiquitinase activity and thiol-dependent deubiquitinase. Predicted to be involved in protein K63-linked deubiquitination. Located in membrane. [provided by Alliance of Genome Resources, Apr 2022]
ACTA2-AS1 (HGNC:45169): (ACTA2 antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
ACTA2NM_001613.4 linkc.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT 3_prime_UTR_variant 9/9 ENST00000224784.10 NP_001604.1 P62736D2JYH4

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
ACTA2ENST00000224784 linkc.*6_*38delTTTCCTGCTCCTCTCTGTCTCTAGCACACAACT 3_prime_UTR_variant 9/91 NM_001613.4 ENSP00000224784.6 P62736

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Familial thoracic aortic aneurysm and aortic dissection Uncertain:2
Uncertain significance, criteria provided, single submitterclinical testingAll of Us Research Program, National Institutes of HealthJun 26, 2023This variant is located in the 3' untranslated region of the ACTA2 gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with ACTA2-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Uncertain significance, criteria provided, single submitterclinical testingColor Diagnostics, LLC DBA Color HealthMay 31, 2023This variant is located in the 3' untranslated region of the ACTA2 gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with ACTA2-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1845709130; hg19: chr10-90694941; API