11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C

Variant names:

• chr11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C
• NM_000317.3:c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2 PP5_Very_Strong

The NM_000317.3(PTS):​c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA variant causes a 5 prime UTR truncation, exon loss change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: PTS NM_000317.3 5_prime_UTR_truncation, exon_loss
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 1.18

Genes affected

PTS (HGNC:9689): (6-pyruvoyltetrahydropterin synthase) The enzyme encoded by this gene catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C is Pathogenic according to our data. Variant chr11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1067052.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PTS	NM_000317.3	c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 6	ENST00000280362.8	NP_000308.1
PTS	NM_000317.3	c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA		5_prime_UTR_truncation, exon_loss_variant	Exon 1 of 6	ENST00000280362.8	NP_000308.1
PTS	NM_000317.3	c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA		upstream_gene_variant		ENST00000280362.8	NP_000308.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PTS	ENST00000280362.8	c.-24_9delAGCACCGCAGACAGCGCCGGGAAGATGAGCACG	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 6	1	NM_000317.3	ENSP00000280362.3
PTS	ENST00000280362	c.-24_9delAGCACCGCAGACAGCGCCGGGAAGATGAGCACG		5_prime_UTR_truncation, exon_loss_variant	Exon 1 of 6	1	NM_000317.3	ENSP00000280362.3
PTS	ENST00000280362.8	c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA		upstream_gene_variant		1	NM_000317.3	ENSP00000280362.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

6-Pyruvoyl-tetrahydrobiopterin synthase deficiency Pathogenic:4

Apr 05, 2023

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 08, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the PTS mRNA. The next in-frame methionine is located at codon 69. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PTS-related conditions. ClinVar contains an entry for this variant (Variation ID: 1067052). This variant disrupts a region of the PTS protein in which other variant(s) (p.Arg25Gly) have been determined to be pathogenic (PMID: 9450907, 23138986). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Mar 04, 2020

Natera, Inc.

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

May 19, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-112097140;