chr11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2PP5_Very_Strong

The NM_000317.3(PTS):​c.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA variant causes a 5 prime UTR truncation, exon loss change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 31)

Consequence

PTS
NM_000317.3 5_prime_UTR_truncation, exon_loss

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 1.18
Variant links:
Genes affected
PTS (HGNC:9689): (6-pyruvoyltetrahydropterin synthase) The enzyme encoded by this gene catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. [provided by RefSeq, Oct 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C is Pathogenic according to our data. Variant chr11-112226417-CCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1067052.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PTSNM_000317.3 linkc.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA p.Met1fs frameshift_variant, start_lost Exon 1 of 6 ENST00000280362.8 NP_000308.1 Q03393
PTSNM_000317.3 linkc.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA 5_prime_UTR_truncation, exon_loss_variant Exon 1 of 6 ENST00000280362.8 NP_000308.1 Q03393
PTSNM_000317.3 linkc.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA upstream_gene_variant ENST00000280362.8 NP_000308.1 Q03393

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PTSENST00000280362.8 linkc.-24_9delAGCACCGCAGACAGCGCCGGGAAGATGAGCACG p.Met1fs frameshift_variant, start_lost Exon 1 of 6 1 NM_000317.3 ENSP00000280362.3 Q03393
PTSENST00000280362 linkc.-24_9delAGCACCGCAGACAGCGCCGGGAAGATGAGCACG 5_prime_UTR_truncation, exon_loss_variant Exon 1 of 6 1 NM_000317.3 ENSP00000280362.3 Q03393
PTSENST00000280362.8 linkc.-26_7delCGAGCACCGCAGACAGCGCCGGGAAGATGAGCA upstream_gene_variant 1 NM_000317.3 ENSP00000280362.3 Q03393

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

6-Pyruvoyl-tetrahydrobiopterin synthase deficiency Pathogenic:4
Apr 05, 2023
Baylor Genetics
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

May 08, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change affects the initiator methionine of the PTS mRNA. The next in-frame methionine is located at codon 69. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PTS-related conditions. ClinVar contains an entry for this variant (Variation ID: 1067052). This variant disrupts a region of the PTS protein in which other variant(s) (p.Arg25Gly) have been determined to be pathogenic (PMID: 9450907, 23138986). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Mar 04, 2020
Natera, Inc.
Significance: Likely pathogenic
Review Status: no assertion criteria provided
Collection Method: clinical testing

- -

May 19, 2024
Fulgent Genetics, Fulgent Genetics
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-112097140; API