11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PP3PP5

The NM_003477.3(PDHX):​c.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

PDHX
NM_003477.3 exon_loss, splice_region

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 8.38
Variant links:
Genes affected
PDHX (HGNC:21350): (pyruvate dehydrogenase complex component X) The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G is Pathogenic according to our data. Variant chr11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G is described in ClinVar as [Pathogenic]. Clinvar id is 2112.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
PDHXNM_003477.3 linkuse as main transcriptc.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant 8/11 ENST00000227868.9 NP_003468.2 O00330-1
PDHXNM_001135024.2 linkuse as main transcriptc.785_843delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant 8/11 NP_001128496.2 O00330
PDHXXM_011520390.2 linkuse as main transcriptc.785_843delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant 8/11 XP_011518692.1 A0A8C8MSB2
PDHXNM_001166158.2 linkuse as main transcriptc.343-6446_343-6388delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA intron_variant NP_001159630.1 O00330-2

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
PDHXENST00000227868.9 linkuse as main transcriptc.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant 8/111 NM_003477.3 ENSP00000227868.4 O00330-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Pyruvate dehydrogenase E3-binding protein deficiency Pathogenic:1
Pathogenic, no assertion criteria providedliterature onlyOMIMDec 01, 1997- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554989996; hg19: chr11-34999670; API