rs1554989996
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PP3PP5
The NM_003477.3(PDHX):c.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Genomes: not found (cov: 32)
Consequence
PDHX
NM_003477.3 exon_loss, splice_region
NM_003477.3 exon_loss, splice_region
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 8.38
Genes affected
PDHX (HGNC:21350): (pyruvate dehydrogenase complex component X) The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G is Pathogenic according to our data. Variant chr11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G is described in ClinVar as [Pathogenic]. Clinvar id is 2112.Status of the report is no_assertion_criteria_provided, 0 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PDHX | NM_003477.3 | c.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA | exon_loss_variant, splice_region_variant | Exon 8 of 11 | ENST00000227868.9 | NP_003468.2 | ||
PDHX | NM_001135024.2 | c.785_843delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA | exon_loss_variant, splice_region_variant | Exon 8 of 11 | NP_001128496.2 | |||
PDHX | XM_011520390.2 | c.785_843delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA | exon_loss_variant, splice_region_variant | Exon 8 of 11 | XP_011518692.1 | |||
PDHX | NM_001166158.2 | c.343-6446_343-6388delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA | intron_variant | Intron 3 of 5 | NP_001159630.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PDHX | ENST00000227868.9 | c.965-12_1011delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA | p.Asp322fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 8 of 11 | 1 | NM_003477.3 | ENSP00000227868.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link
Submissions by phenotype
Pyruvate dehydrogenase E3-binding protein deficiency Pathogenic:1
Dec 01, 1997
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at