11-47335940-G-GCCGCCACTTGAGGGAGACCGTGGTGT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000256.3(MYBPC3):c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG(p.Pro892ThrfsTer41) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000256.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 4Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- left ventricular noncompaction 10Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- atrial fibrillationInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- dilated cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | NM_000256.3 | MANE Select | c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG | p.Pro892ThrfsTer41 | frameshift | Exon 26 of 35 | NP_000247.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | ENST00000545968.6 | TSL:5 MANE Select | c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG | p.Pro892ThrfsTer41 | frameshift | Exon 26 of 35 | ENSP00000442795.1 | ||
| MYBPC3 | ENST00000399249.6 | TSL:5 | c.2648_2673dupACACCACGGTCTCCCTCAAGTGGCGG | p.Pro892ThrfsTer41 | frameshift | Exon 25 of 34 | ENSP00000382193.2 | ||
| MYBPC3 | ENST00000544791.1 | TSL:5 | n.*153_*178dupACACCACGGTCTCCCTCAAGTGGCGG | non_coding_transcript_exon | Exon 26 of 27 | ENSP00000444259.1 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 exome Cov.: 33
GnomAD4 genome Cov.: 30
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at