11-694780-CGGCCTCGTCGGGGCCGGGCAG-C

Variant names:

• chr11-694780-CGGCCTCGTCGGGGCCGGGCAG-C
• NM_021008.4:c.247_267delCTGCCCGGCCCCGACGAGGCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_021008.4(DEAF1):​c.247_267delCTGCCCGGCCCCGACGAGGCC​(p.Leu83_Ala89del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.00000169 in 1,181,800 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000017 (0 hom.)
• Consequence: DEAF1 NM_021008.4 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.59

Genes affected

DEAF1 (HGNC:14677): (DEAF1 transcription factor) This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

EPS8L2 (HGNC:21296): (EPS8 signaling adaptor L2) This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_021008.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DEAF1	NM_021008.4	c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 12	ENST00000382409.4	NP_066288.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DEAF1	ENST00000382409.4	c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 12	1	NM_021008.4	ENSP00000371846.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000169 AC: 2 AN: 1181800 Hom.: 0 AF XY: 0.00000175 AC XY: 1 AN XY: 572824

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000204

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-694780;