11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4BP6BS2
The NM_021008.4(DEAF1):c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG(p.Val19_Ala27del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000207 in 1,140,816 control chromosomes in the GnomAD database, including 23 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. V19V) has been classified as Likely benign.
Frequency
Consequence
NM_021008.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hearing loss, autosomal recessive 106Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- nonsyndromic genetic hearing lossInheritance: AR Classification: MODERATE Submitted by: ClinGen
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_021008.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DEAF1 | MANE Select | c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG | p.Val19_Ala27del | disruptive_inframe_deletion | Exon 1 of 12 | NP_066288.2 | |||
| DEAF1 | c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG | p.Val19_Ala27del | disruptive_inframe_deletion | Exon 1 of 11 | NP_001427812.1 | ||||
| DEAF1 | c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG | p.Val19_Ala27del | disruptive_inframe_deletion | Exon 1 of 11 | NP_001427813.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DEAF1 | TSL:1 MANE Select | c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG | p.Val19_Ala27del | disruptive_inframe_deletion | Exon 1 of 12 | ENSP00000371846.3 | O75398-1 | ||
| DEAF1 | c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG | p.Val19_Ala27del | disruptive_inframe_deletion | Exon 1 of 13 | ENSP00000552156.1 | ||||
| DEAF1 | c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG | p.Val19_Ala27del | disruptive_inframe_deletion | Exon 1 of 12 | ENSP00000587864.1 |
Frequencies
GnomAD3 genomes AF: 0.000190 AC: 28AN: 147146Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000371 AC: 11AN: 29622 AF XY: 0.000362 show subpopulations
GnomAD4 exome AF: 0.000209 AC: 208AN: 993560Hom.: 23 AF XY: 0.000220 AC XY: 105AN XY: 477822 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000190 AC: 28AN: 147256Hom.: 0 Cov.: 32 AF XY: 0.000251 AC XY: 18AN XY: 71830 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at