NM_021008.4:c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG

Variant names:

• chr11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G
• rs768085739
• NM_021008.4:c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_021008.4(DEAF1):​c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG​(p.Val19_Ala27del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000207 in 1,140,816 control chromosomes in the GnomAD database, including 23 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00019 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (23 hom.)
• Consequence: DEAF1 NM_021008.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: 2.45

Genes affected

DEAF1 (HGNC:14677): (DEAF1 transcription factor) This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

EPS8L2 (HGNC:21296): (EPS8 signaling adaptor L2) This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021008.4.
• BP6: Variant 11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G is Benign according to our data. Variant chr11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 434934.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Uncertain_significance=2}.
• BS2: High Homozygotes in GnomAdExome4 at 23 SD gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DEAF1	NM_021008.4	c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 12	ENST00000382409.4	NP_066288.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DEAF1	ENST00000382409.4	c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 12	1	NM_021008.4	ENSP00000371846.3

Frequencies

GnomAD3 genomes AF: 0.000190 AC: 28 AN: 147146 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000148

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000203

Gnomad ASJ AF: 0.000300

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000677

Gnomad FIN AF: 0.000103

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000211

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000371 AC: 11 AN: 29622 Hom.: 1 AF XY: 0.000362 AC XY: 7 AN XY: 19338

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00139

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000253

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000513

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000209 AC: 208 AN: 993560 Hom.: 23 AF XY: 0.000220 AC XY: 105 AN XY: 477822

Gnomad4 AFR exome AF: 0.000158

Gnomad4 AMR exome AF: 0.000328

Gnomad4 ASJ exome AF: 0.0000861

Gnomad4 EAS exome AF: 0.000316

Gnomad4 SAS exome AF: 0.000785

Gnomad4 FIN exome AF: 0.000174

Gnomad4 NFE exome AF: 0.000193

Gnomad4 OTH exome AF: 0.000193

GnomAD4 genome AF: 0.000190 AC: 28 AN: 147256 Hom.: 0 Cov.: 32 AF XY: 0.000251 AC XY: 18 AN XY: 71830

Gnomad4 AFR AF: 0.000147

Gnomad4 AMR AF: 0.000203

Gnomad4 ASJ AF: 0.000300

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000676

Gnomad4 FIN AF: 0.000103

Gnomad4 NFE AF: 0.000211

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000712 Hom.: 0

Bravo AF: 0.000155

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:1

Dec 15, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.56_82del, results in the deletion of 9 amino acid(s) of the DEAF1 protein (p.Val19_Ala27del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with DEAF1-related conditions. ClinVar contains an entry for this variant (Variation ID: 434934). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Mar 01, 2024

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

DEAF1: BP3 -

not specified Uncertain:1

Sep 30, 2015

Genetic Services Laboratory, University of Chicago

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs768085739; hg19: chr11-694965;