rs768085739

Variant names:

• chr11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G
• rs768085739
• NM_021008.4:c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_021008.4(DEAF1):​c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG​(p.Val19_Ala27del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000207 in 1,140,816 control chromosomes in the GnomAD database, including 23 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. V19V) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00019 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (23 hom.)
• Consequence: DEAF1 NM_021008.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: 2.45
• Publications: 0 publications found

Genes affected

DEAF1 (HGNC:14677): (DEAF1 transcription factor) This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

EPS8L2 (HGNC:21296): (EPS8 signaling adaptor L2) This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]

EPS8L2 Gene-Disease associations (from GenCC):

• hearing loss, autosomal recessive 106

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: MODERATE Submitted by: ClinGen
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021008.4.
• BP6: Variant 11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G is Benign according to our data. Variant chr11-694965-GCCGCCGCCACAGCGGCCGCGGCCGCCA-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 434934.
• BS2: High Homozygotes in GnomAdExome4 at 23 AD,AR,SD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021008.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DEAF1	NM_021008.4	MANE Select	c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 12	NP_066288.2
	DEAF1	NM_001440883.1		c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 11	NP_001427812.1
	DEAF1	NM_001440884.1		c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 11	NP_001427813.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DEAF1	ENST00000382409.4	TSL:1 MANE Select	c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 12	ENSP00000371846.3	O75398-1
	DEAF1	ENST00000882097.1		c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 13	ENSP00000552156.1
	DEAF1	ENST00000917805.1		c.56_82delTGGCGGCCGCGGCCGCTGTGGCGGCGG	p.Val19_Ala27del	disruptive_inframe_deletion	Exon 1 of 12	ENSP00000587864.1

Frequencies

GnomAD3 genomes AF: 0.000190 AC: 28 AN: 147146 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000148

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000203

Gnomad ASJ AF: 0.000300

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000677

Gnomad FIN AF: 0.000103

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000211

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000371 AC: 11 AN: 29622 AF XY: 0.000362

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00139

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000513

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000209 AC: 208 AN: 993560 Hom.: 23 AF XY: 0.000220 AC XY: 105 AN XY: 477822

African (AFR) AF: 0.000158 AC: 3 AN: 18992

American (AMR) AF: 0.000328 AC: 2 AN: 6106

Ashkenazi Jewish (ASJ) AF: 0.0000861 AC: 1 AN: 11616

East Asian (EAS) AF: 0.000316 AC: 5 AN: 15828

South Asian (SAS) AF: 0.000785 AC: 21 AN: 26768

European-Finnish (FIN) AF: 0.000174 AC: 2 AN: 11520

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2440

European-Non Finnish (NFE) AF: 0.000193 AC: 167 AN: 864068

Other (OTH) AF: 0.000193 AC: 7 AN: 36222

GnomAD4 genome AF: 0.000190 AC: 28 AN: 147256 Hom.: 0 Cov.: 32 AF XY: 0.000251 AC XY: 18 AN XY: 71830

African (AFR) AF: 0.000147 AC: 6 AN: 40712

American (AMR) AF: 0.000203 AC: 3 AN: 14792

Ashkenazi Jewish (ASJ) AF: 0.000300 AC: 1 AN: 3336

East Asian (EAS) AF: 0.00 AC: 0 AN: 4784

South Asian (SAS) AF: 0.000676 AC: 3 AN: 4438

European-Finnish (FIN) AF: 0.000103 AC: 1 AN: 9688

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.000211 AC: 14 AN: 66286

Other (OTH) AF: 0.00 AC: 0 AN: 2034

Alfa AF: 0.0000712 Hom.: 0

Bravo AF: 0.000155

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	1	not provided (2)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.5
Mutation Taster		=197/3	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs768085739; hg19: chr11-694965;