11-77184725-GGGAGGCGGGGACACCAGGGCCT-GGGAGGCGGGGACACCAGGGCCTGGAGGCGGGGACACCAGGGCCT

Variant names:

• chr11-77184725-G-GGGAGGCGGGGACACCAGGGCCT
• rs111033223
• NM_000260.4:c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_000260.4(MYO7A):​c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: MYO7A NM_000260.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.0900

Genes affected

MYO7A (HGNC:7606): (myosin VIIA) This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYO7A	NM_000260.4	c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron_variant	Intron 27 of 48	ENST00000409709.9	NP_000251.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYO7A	ENST00000409709.9	c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron_variant	Intron 27 of 48	1	NM_000260.4	ENSP00000386331.3
MYO7A	ENST00000458637.6	c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron_variant	Intron 27 of 48	1		ENSP00000392185.2
MYO7A	ENST00000409619.6	c.3470+12_3470+33dupGAGGCGGGGACACCAGGGCCTG		intron_variant	Intron 28 of 49	1		ENSP00000386635.2
MYO7A	ENST00000458169.2	c.1046+12_1046+33dupGAGGCGGGGACACCAGGGCCTG		intron_variant	Intron 7 of 28	1		ENSP00000417017.2
MYO7A	ENST00000670577.1	n.1343+12_1343+33dupGAGGCGGGGACACCAGGGCCTG		intron_variant	Intron 10 of 31			ENSP00000499323.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs111033223; hg19: chr11-76895770;