rs111033223
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1
This summary comes from the ClinGen Evidence Repository: The filtering allele frequency of the c.3503+12_3503+33del (p.Gly1172GlufsX34) variant in the MYO7A gene is 50.8% (11084/21494) of European (Finnish) chromosomes by the Genome Aggregation Database (http://gnomad.broadinstitute.org; calculated by using inverse allele frequency at https://www.cardiodb.org/allelefrequencyapp/), which is a high enough frequency to be classified as benign based on thresholds defined by the ClinGen Hearing Loss Expert Panel for autosomal recessive hearing loss variants (BA1). LINK:https://erepo.genome.network/evrepo/ui/classification/CA132294/MONDO:0019497/005
Frequency
Consequence
NM_000260.4 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MYO7A | ENST00000409709.9 | c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG | intron_variant | Intron 27 of 48 | 1 | NM_000260.4 | ENSP00000386331.3 | |||
MYO7A | ENST00000458637.6 | c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG | intron_variant | Intron 27 of 48 | 1 | ENSP00000392185.2 | ||||
MYO7A | ENST00000409619.6 | c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG | intron_variant | Intron 28 of 49 | 1 | ENSP00000386635.2 | ||||
MYO7A | ENST00000458169.2 | c.1046+12_1046+33delGAGGCGGGGACACCAGGGCCTG | intron_variant | Intron 7 of 28 | 1 | ENSP00000417017.2 | ||||
MYO7A | ENST00000670577.1 | n.1343+12_1343+33delGAGGCGGGGACACCAGGGCCTG | intron_variant | Intron 10 of 31 | ENSP00000499323.1 |
Frequencies
GnomAD3 genomes AF: 0.455 AC: 69092AN: 151924Hom.: 16041 Cov.: 0 show subpopulations
GnomAD2 exomes AF: 0.380 AC: 76594AN: 201658 AF XY: 0.368 show subpopulations
GnomAD4 exome AF: 0.456 AC: 649803AN: 1426072Hom.: 154611 AF XY: 0.449 AC XY: 317982AN XY: 707850 show subpopulations
GnomAD4 genome AF: 0.455 AC: 69133AN: 152042Hom.: 16051 Cov.: 0 AF XY: 0.456 AC XY: 33879AN XY: 74326 show subpopulations
ClinVar
Submissions by phenotype
not specified Benign:5
See NM_000260 c.3503+12_3503+33del -
- -
- -
- -
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
Autosomal recessive nonsyndromic hearing loss 2 Benign:1
- -
Usher syndrome type 1B Benign:1
- -
Nonsyndromic genetic hearing loss Benign:1
The filtering allele frequency of the c.3503+12_3503+33del (p.Gly1172GlufsX34) variant in the MYO7A gene is 50.8% (11084/21494) of European (Finnish) chromosomes by the Genome Aggregation Database (http://gnomad.broadinstitute.org; calculated by using inverse allele frequency at https://www.cardiodb.org/allelefrequencyapp/), which is a high enough frequency to be classified as benign based on thresholds defined by the ClinGen Hearing Loss Expert Panel for autosomal recessive hearing loss variants (BA1). -
not provided Benign:1
- -
Usher syndrome type 1;C1832475:Autosomal dominant nonsyndromic hearing loss 11;C1838701:Autosomal recessive nonsyndromic hearing loss 2 Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at