chr11-77184725-G-GGGAGGCGGGGACACCAGGGCCT

Variant names:

• chr11-77184725-G-GGGAGGCGGGGACACCAGGGCCT
• rs111033223
• NM_000260.4:c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000260.4(MYO7A):​c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 0)
• Consequence: MYO7A NM_000260.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.0900
• Publications: 14 publications found

Genes affected

MYO7A (HGNC:7606): (myosin VIIA) This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

MYO7A Gene-Disease associations (from GenCC):

• nonsyndromic genetic hearing loss

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• autosomal recessive nonsyndromic hearing loss 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Ambry Genetics, G2P
• Usher syndrome type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, PanelApp Australia
• Usher syndrome type 1B

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• autosomal dominant nonsyndromic hearing loss 11

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• autosomal dominant nonsyndromic hearing loss

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Usher syndrome type 2

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000260.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYO7A	NM_000260.4	MANE Select	c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron	N/A	NP_000251.3
	MYO7A	NM_001127180.2		c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron	N/A	NP_001120652.1
	MYO7A	NM_001369365.1		c.3470+12_3470+33dupGAGGCGGGGACACCAGGGCCTG		intron	N/A	NP_001356294.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYO7A	ENST00000409709.9	TSL:1 MANE Select	c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron	N/A	ENSP00000386331.3
	MYO7A	ENST00000458637.6	TSL:1	c.3503+12_3503+33dupGAGGCGGGGACACCAGGGCCTG		intron	N/A	ENSP00000392185.2
	MYO7A	ENST00000409619.6	TSL:1	c.3470+12_3470+33dupGAGGCGGGGACACCAGGGCCTG		intron	N/A	ENSP00000386635.2

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.090

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs111033223; hg19: chr11-76895770;