11-78069979-TGAAGACTTCAACGTATTGGATG-T

Position:

• chr11-78069979-TGAAGACTTCAACGTATTGGATG-T

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP5_Moderate

The NM_004549.6(NDUFC2):​c.346_*7delCATCCAATACGTTGAAGTCTTC​(p.His116fs) variant causes a frameshift, stop lost change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NDUFC2 NM_004549.6 frameshift, stop_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 5.02

Genes affected

NDUFC2 (HGNC:7706): (NADH:ubiquinone oxidoreductase subunit C2) Involved in mitochondrial respiratory chain complex I assembly. Located in mitochondrion. Part of mitochondrial respiratory chain complex I. Implicated in nuclear type mitochondrial complex I deficiency. [provided by Alliance of Genome Resources, Apr 2022]

NDUFC2-KCTD14 (HGNC:42956): (NDUFC2-KCTD14 readthrough) This locus represents naturally occurring read-through transcription between the neighboring NDUFC2 (NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa) and KCTD14 (potassium channel tetramerisation domain containing 14) genes on chromosome 11. The read-through transcripts share sequence identity with the upstream gene product and one variant has a frameshifted C-terminal region derived from the downstream gene exons. [provided by RefSeq, Feb 2011]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Stoplost variant in NM_004549.6
• PP5: Variant 11-78069979-TGAAGACTTCAACGTATTGGATG-T is Pathogenic according to our data. Variant chr11-78069979-TGAAGACTTCAACGTATTGGATG-T is described in ClinVar as [Pathogenic]. Clinvar id is 813296.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NDUFC2	NM_004549.6	c.346_*7delCATCCAATACGTTGAAGTCTTC	p.His116fs	frameshift_variant, stop_lost	3/3	ENST00000281031.5	NP_004540.1
NDUFC2	NM_004549.6	c.346_*7delCATCCAATACGTTGAAGTCTTC		3_prime_UTR_variant	3/3	ENST00000281031.5	NP_004540.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NDUFC2	ENST00000281031.5	c.346_*7delCATCCAATACGTTGAAGTCTTC	p.His116fs	frameshift_variant, stop_lost	3/3	1	NM_004549.6	ENSP00000281031.4
NDUFC2	ENST00000281031.5	c.346_*7delCATCCAATACGTTGAAGTCTTC		3_prime_UTR_variant	3/3	1	NM_004549.6	ENSP00000281031.4
NDUFC2-KCTD14	ENST00000612612.5	c.310+2997_310+3018delCATCCAATACGTTGAAGTCTTC		intron_variant		2		ENSP00000478766.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Mitochondrial disease Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Wellcome Centre for Mitochondrial Research, Newcastle University

Feb 10, 2020

- -

Mitochondrial complex 1 deficiency, nuclear type 36 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 29, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1858924087; hg19: chr11-77781025;