12-111598978-TTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Position:

• chr12-111598978-TTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001372574.1(ATXN2):​c.30_56dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln11_Gln19dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000436 in 137,578 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q19Q) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.000044 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000039 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN2 NM_001372574.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.273

Genes affected

ATXN2 (HGNC:10555): (ataxin 2) This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

ATXN2 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001372574.1
• BS2: High AC in GnomAd4 at 6 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN2	NM_001372574.1	c.30_56dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln11_Gln19dup	disruptive_inframe_insertion	1/25	ENST00000673436.1	NP_001359503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATXN2	ENST00000673436.1	c.30_56dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln11_Gln19dup	disruptive_inframe_insertion	1/25		NM_001372574.1	ENSP00000500925.1

Frequencies

GnomAD3 genomes AF: 0.0000436 AC: 6 AN: 137578 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000265

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000801

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000390 AC: 45 AN: 1155284 Hom.: 0 Cov.: 74 AF XY: 0.0000405 AC XY: 23 AN XY: 568164

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000368

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000338

Gnomad4 FIN exome AF: 0.0000311

Gnomad4 NFE exome AF: 0.0000427

Gnomad4 OTH exome AF: 0.0000416

GnomAD4 genome AF: 0.0000436 AC: 6 AN: 137578 Hom.: 0 Cov.: 32 AF XY: 0.0000448 AC XY: 3 AN XY: 66910

Gnomad4 AFR AF: 0.0000265

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000801

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922927; hg19: chr12-112036782;