12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-G
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The ENST00000537064.5(POLE):n.*2311_*2322+13delTGTCACGGAGAGGTGAGGGCTCCCC variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000112 in 1,610,294 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
ENST00000537064.5 splice_region, non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- POLE-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 12Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- facial dysmorphism-immunodeficiency-livedo-short stature syndromeInheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
- intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiencyInheritance: AR Classification: STRONG Submitted by: G2P
- IMAGe syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000537064.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLE | NM_006231.4 | MANE Select | c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC | p.Val1089_Arg1092del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 26 of 49 | NP_006222.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLE | ENST00000537064.5 | TSL:1 | n.*2311_*2322+13delTGTCACGGAGAGGTGAGGGCTCCCC | splice_region non_coding_transcript_exon | Exon 26 of 49 | ENSP00000442578.1 | |||
| POLE | ENST00000320574.10 | TSL:1 MANE Select | c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC | p.Val1089_Arg1092del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 26 of 49 | ENSP00000322570.5 | ||
| POLE | ENST00000535270.5 | TSL:1 | c.3183_3194+13delTGTCACGGAGAGGTGAGGGCTCCCC | p.Val1062_Arg1065del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 25 of 48 | ENSP00000445753.1 |
Frequencies
GnomAD3 genomes AF: 0.0000198 AC: 3AN: 151554Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.0000121 AC: 3AN: 247110 AF XY: 0.0000149 show subpopulations
GnomAD4 exome AF: 0.0000103 AC: 15AN: 1458740Hom.: 0 AF XY: 0.0000110 AC XY: 8AN XY: 725774 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000198 AC: 3AN: 151554Hom.: 0 Cov.: 33 AF XY: 0.0000270 AC XY: 2AN XY: 74030 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Pathogenic:4
This variant results in the deletion of part of exon 26 (c.3264_3275+13del) of the POLE gene. RNA analysis indicates that this variant induces altered splicing and may result in an absent or altered protein product. This variant is present in population databases (rs761516512, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 473580). Studies have shown that this variant results in activation of a cryptic splice site, and produces a non-functional protein and/or introduces a premature termination codon (internal data). For these reasons, this variant has been classified as Pathogenic.
Canonical splice site variant predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 34502317, 36395985, 35312039, 30503519)
Hereditary cancer-predisposing syndrome Uncertain:1
The c.3264_3275+13del25 variant spans the boundary of coding exon 26 and intron 26 in the POLE gene. This variant results from a deletion of 25 nucleotides at positions c.3264 to c.3275+13. This variant has been identified in trans with a second POLE variant in an individual with features consistent with POLE deficiency (Logan CV et al. Am J Hum Genet, 2018 Dec;103:1038-1044). These nucleotide positions are well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site and may result in the creation or strengthening of a novel splice donor site; however, direct evidence is unavailable. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. Loss-of-function variants subject to nonsense mediated decay (NMD) in POLE are known to cause POLE deficiency; however, such associations with POLE-related polymerase proofreading-associated polyposis (PPAP) have not been reported. Based on the supporting evidence, this alteration is pathogenic for POLE deficiency; however, the association of this alteration with POLE-related polymerase proofreading-associated polyposis (PPAP) and POLE-related CMMRD-like syndrome is unknown.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at