12-49051406-TGGCTCCTCAGGCCGGGGGGACAGGTGC-TGGCTCCTCAGGCCGGGGGGACAGGTGCGGCTCCTCAGGCCGGGGGGACAGGTGC

Variant names:

• chr12-49051406-T-TGGCTCCTCAGGCCGGGGGGACAGGTGC
• rs587778449
• NM_003482.4:c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_003482.4(KMT2D):​c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC​(p.Pro759_His760insHisLeuSerProArgProGluGluPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000106 in 1,603,008 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000021 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000096 (0 hom.)
• Consequence: KMT2D NM_003482.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: -0.0500

Genes affected

KMT2D (HGNC:7133): (lysine methyltransferase 2D) The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003482.4.
• BS2: High AC in GnomAdExome4 at 14 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KMT2D	NM_003482.4	c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC	p.Pro759_His760insHisLeuSerProArgProGluGluPro	disruptive_inframe_insertion	Exon 11 of 55	ENST00000301067.12	NP_003473.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KMT2D	ENST00000301067.12	c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC	p.Pro759_His760insHisLeuSerProArgProGluGluPro	disruptive_inframe_insertion	Exon 11 of 55	5	NM_003482.4	ENSP00000301067.7
KMT2D	ENST00000683543.2	c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC	p.Pro759_His760insHisLeuSerProArgProGluGluPro	disruptive_inframe_insertion	Exon 11 of 56			ENSP00000506726.1
KMT2D	ENST00000685166.1	c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC	p.Pro759_His760insHisLeuSerProArgProGluGluPro	disruptive_inframe_insertion	Exon 10 of 54			ENSP00000509386.1
KMT2D	ENST00000692637.1	c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC	p.Pro759_His760insHisLeuSerProArgProGluGluPro	disruptive_inframe_insertion	Exon 10 of 54			ENSP00000509666.1

Frequencies

GnomAD3 genomes AF: 0.0000209 AC: 3 AN: 143218 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000264

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000307

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000206 AC: 5 AN: 242168 Hom.: 0 AF XY: 0.0000302 AC XY: 4 AN XY: 132466

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000984

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000185

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000959 AC: 14 AN: 1459790 Hom.: 0 Cov.: 37 AF XY: 0.00000964 AC XY: 7 AN XY: 726166

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000348

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000990

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000209 AC: 3 AN: 143218 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 70096

Gnomad4 AFR AF: 0.0000264

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000307

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Kabuki syndrome Uncertain:1

Oct 24, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.2250_2276dup, results in the insertion of 9 amino acid(s) of the KMT2D protein (p.Arg755_Pro763dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with KMT2D-related conditions. ClinVar contains an entry for this variant (Variation ID: 1328773). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Dec 07, 2021

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame insertion of 9 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -

Choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndrome;CN030661:Kabuki syndrome 1 Uncertain:1

Mar 29, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587778449; hg19: chr12-49445189;