rs587778449

Positions:

• chr12-49051406-TGGCTCCTCAGGCCGGGGGGACAGGTGC-T
• chr12-49051406-TGGCTCCTCAGGCCGGGGGGACAGGTGC-TGGCTCCTCAGGCCGGGGGGACAGGTGCGGCTCCTCAGGCCGGGGGGACAGGTGC

Variant summary

Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_003482.4(KMT2D):​c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC​(p.His751_Pro759del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00101 in 1,603,084 control chromosomes in the GnomAD database, including 11 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0054 (8 hom., cov: 31)
  • Exomes 𝑓: 0.00058 (3 hom.)
• Consequence: KMT2D NM_003482.4 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:6 O:1
• Conservation: PhyloP100: 1.58

Genes affected

KMT2D (HGNC:7133): (lysine methyltransferase 2D) The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Benign. Variant got -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003482.4.
• BP6: Variant 12-49051406-TGGCTCCTCAGGCCGGGGGGACAGGTGC-T is Benign according to our data. Variant chr12-49051406-TGGCTCCTCAGGCCGGGGGGACAGGTGC-T is described in ClinVar as [Likely_benign]. Clinvar id is 134661.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr12-49051406-TGGCTCCTCAGGCCGGGGGGACAGGTGC-T is described in Lovd as [Benign].
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00537 (769/143318) while in subpopulation AFR AF= 0.019 (722/38012). AF 95% confidence interval is 0.0178. There are 8 homozygotes in gnomad4. There are 362 alleles in male gnomad4 subpopulation. Median coverage is 31. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 769 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KMT2D	NM_003482.4	c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC	p.His751_Pro759del	disruptive_inframe_deletion	11/55	ENST00000301067.12	NP_003473.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KMT2D	ENST00000301067.12	c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC	p.His751_Pro759del	disruptive_inframe_deletion	11/55	5	NM_003482.4	ENSP00000301067.7
KMT2D	ENST00000683543.2	c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC	p.His751_Pro759del	disruptive_inframe_deletion	11/56			ENSP00000506726.1
KMT2D	ENST00000685166.1	c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC	p.His751_Pro759del	disruptive_inframe_deletion	10/54			ENSP00000509386.1
KMT2D	ENST00000692637.1	c.2250_2276delGCACCTGTCCCCCCGGCCTGAGGAGCC	p.His751_Pro759del	disruptive_inframe_deletion	10/54			ENSP00000509666.1

Frequencies

GnomAD3 genomes AF: 0.00535 AC: 766 AN: 143200 Hom.: 8 Cov.: 31

Gnomad AFR AF: 0.0189

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00156

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000677

Gnomad FIN AF: 0.000203

Gnomad MID AF: 0.00794

Gnomad NFE AF: 0.0000920

Gnomad OTH AF: 0.00601

GnomAD3 exomes AF: 0.00128 AC: 309 AN: 242168 Hom.: 0 AF XY: 0.00101 AC XY: 134 AN XY: 132466

Gnomad AFR exome AF: 0.0187

Gnomad AMR exome AF: 0.000669

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000224

Gnomad SAS exome AF: 0.0000984

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000120

Gnomad OTH exome AF: 0.000337

GnomAD4 exome AF: 0.000579 AC: 845 AN: 1459766 Hom.: 3 AF XY: 0.000549 AC XY: 399 AN XY: 726154

Gnomad4 AFR exome AF: 0.0182

Gnomad4 AMR exome AF: 0.000964

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000504

Gnomad4 SAS exome AF: 0.000255

Gnomad4 FIN exome AF: 0.0000189

Gnomad4 NFE exome AF: 0.0000936

Gnomad4 OTH exome AF: 0.00109

GnomAD4 genome AF: 0.00537 AC: 769 AN: 143318 Hom.: 8 Cov.: 31 AF XY: 0.00516 AC XY: 362 AN XY: 70210

Gnomad4 AFR AF: 0.0190

Gnomad4 AMR AF: 0.00156

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000452

Gnomad4 FIN AF: 0.000203

Gnomad4 NFE AF: 0.0000920

Gnomad4 OTH AF: 0.00594

Alfa AF: 0.00388 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:6 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2 Other:1

not provided, no classification provided	reference population	ITMI	Sep 19, 2013	- -
Benign, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Apr 13, 2016	- -
Benign, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	May 30, 2017	- -

not provided Benign:2

Benign, criteria provided, single submitter	clinical testing	GeneDx	Jun 15, 2020	- -
Benign, criteria provided, single submitter	clinical testing	Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics	Sep 01, 2016	- -

Kabuki syndrome 1 Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Mendelics

May 28, 2019

- -

Kabuki syndrome Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 29, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587778449; hg19: chr12-49445189;