12-52790167-C-CGCTGCCACCGCTGAAACCGCT

Position:

• chr12-52790167-C-CGCTGCCACCGCTGAAACCGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_057088.3(KRT3):​c.1741_1761dupAGCGGTTTCAGCGGTGGCAGC​(p.Ser587_Gly588insSerGlyPheSerGlyGlySer) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0472 in 1,547,110 control chromosomes in the GnomAD database, including 3,773 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.097 (1526 hom., cov: 31)
  • Exomes 𝑓: 0.042 (2247 hom.)
• Consequence: KRT3 NM_057088.3 conservative_inframe_insertion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.118

Genes affected

KRT3 (HGNC:6440): (keratin 3) The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the corneal epithelium with family member KRT12 and mutations in these genes have been associated with Meesmann's Corneal Dystrophy. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_057088.3.
• BP6: Variant 12-52790167-C-CGCTGCCACCGCTGAAACCGCT is Benign according to our data. Variant chr12-52790167-C-CGCTGCCACCGCTGAAACCGCT is described in ClinVar as [Benign]. Clinvar id is 768550.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.254 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KRT3	NM_057088.3	c.1741_1761dupAGCGGTTTCAGCGGTGGCAGC	p.Ser587_Gly588insSerGlyPheSerGlyGlySer	conservative_inframe_insertion	9/9	ENST00000417996.2	NP_476429.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KRT3	ENST00000417996.2	c.1741_1761dupAGCGGTTTCAGCGGTGGCAGC	p.Ser587_Gly588insSerGlyPheSerGlyGlySer	conservative_inframe_insertion	9/9	1	NM_057088.3	ENSP00000413479.2

Frequencies

GnomAD3 genomes AF: 0.0972 AC: 14726 AN: 151498 Hom.: 1519 Cov.: 31

Gnomad AFR AF: 0.259

Gnomad AMI AF: 0.00658

Gnomad AMR AF: 0.0598

Gnomad ASJ AF: 0.0573

Gnomad EAS AF: 0.000386

Gnomad SAS AF: 0.00727

Gnomad FIN AF: 0.0198

Gnomad MID AF: 0.0918

Gnomad NFE AF: 0.0379

Gnomad OTH AF: 0.0884

GnomAD4 exome AF: 0.0418 AC: 58344 AN: 1395494 Hom.: 2247 Cov.: 32 AF XY: 0.0401 AC XY: 27574 AN XY: 688446

Gnomad4 AFR exome AF: 0.271

Gnomad4 AMR exome AF: 0.0452

Gnomad4 ASJ exome AF: 0.0541

Gnomad4 EAS exome AF: 0.0000280

Gnomad4 SAS exome AF: 0.00790

Gnomad4 FIN exome AF: 0.0166

Gnomad4 NFE exome AF: 0.0392

Gnomad4 OTH exome AF: 0.0511

GnomAD4 genome AF: 0.0973 AC: 14750 AN: 151616 Hom.: 1526 Cov.: 31 AF XY: 0.0945 AC XY: 7008 AN XY: 74156

Gnomad4 AFR AF: 0.258

Gnomad4 AMR AF: 0.0596

Gnomad4 ASJ AF: 0.0573

Gnomad4 EAS AF: 0.000386

Gnomad4 SAS AF: 0.00748

Gnomad4 FIN AF: 0.0198

Gnomad4 NFE AF: 0.0379

Gnomad4 OTH AF: 0.0875

Alfa AF: 0.0565 Hom.: 30

Asia WGS AF: 0.0180 AC: 66 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 29, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60125653; hg19: chr12-53183951;