12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAG

Variant names:

• chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs60216939
• NM_001940.4:c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_001940.4(ATN1):​c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln494_Gln502del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000476 in 1,584,040 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00066 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00046 (1 hom.)
• Consequence: ATN1 NM_001940.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.09

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP6: Variant 12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as [Likely_benign]. Clinvar id is 2351599.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 96 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATN1	NM_001940.4	c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENST00000396684.3	NP_001931.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATN1	ENST00000396684.3	c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	1	NM_001940.4	ENSP00000379915.2
ATN1	ENST00000356654.8	c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	1		ENSP00000349076.3

Frequencies

GnomAD3 genomes AF: 0.000648 AC: 94 AN: 145032 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000517

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00245

Gnomad ASJ AF: 0.000592

Gnomad EAS AF: 0.000422

Gnomad SAS AF: 0.000226

Gnomad FIN AF: 0.000298

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000420

Gnomad OTH AF: 0.00204

GnomAD4 exome AF: 0.000457 AC: 658 AN: 1438908 Hom.: 1 AF XY: 0.000446 AC XY: 320 AN XY: 716724

Gnomad4 AFR exome AF: 0.000279

Gnomad4 AMR exome AF: 0.00152

Gnomad4 ASJ exome AF: 0.00241

Gnomad4 EAS exome AF: 0.00196

Gnomad4 SAS exome AF: 0.000140

Gnomad4 FIN exome AF: 0.000190

Gnomad4 NFE exome AF: 0.000352

Gnomad4 OTH exome AF: 0.000656

GnomAD4 genome AF: 0.000661 AC: 96 AN: 145132 Hom.: 0 Cov.: 0 AF XY: 0.000667 AC XY: 47 AN XY: 70474

Gnomad4 AFR AF: 0.000568

Gnomad4 AMR AF: 0.00245

Gnomad4 ASJ AF: 0.000592

Gnomad4 EAS AF: 0.000424

Gnomad4 SAS AF: 0.000226

Gnomad4 FIN AF: 0.000298

Gnomad4 NFE AF: 0.000420

Gnomad4 OTH AF: 0.00202

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Benign:1

Oct 14, 2021

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;