NM_001940.4:c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs60216939
• NM_001940.4:c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_001940.4(ATN1):​c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln494_Gln502del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000476 in 1,584,040 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00066 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00046 (1 hom.)
• Consequence: ATN1 NM_001940.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.09
• Publications: 8 publications found

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ATN1 Gene-Disease associations (from GenCC):

• congenital hypotonia, epilepsy, developmental delay, and digital anomalies

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Illumina, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• dentatorubral-pallidoluysian atrophy

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as [Likely_benign]. Clinvar id is 2351599.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 96 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATN1	NM_001940.4	c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	ENST00000396684.3	NP_001931.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATN1	ENST00000396684.3	c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	1	NM_001940.4	ENSP00000379915.2
ATN1	ENST00000356654.8	c.1482_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln494_Gln502del	disruptive_inframe_deletion	Exon 5 of 10	1		ENSP00000349076.3

Frequencies

GnomAD3 genomes AF: 0.000648 AC: 94 AN: 145032 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000517

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00245

Gnomad ASJ AF: 0.000592

Gnomad EAS AF: 0.000422

Gnomad SAS AF: 0.000226

Gnomad FIN AF: 0.000298

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000420

Gnomad OTH AF: 0.00204

GnomAD4 exome AF: 0.000457 AC: 658 AN: 1438908 Hom.: 1 AF XY: 0.000446 AC XY: 320 AN XY: 716724

African (AFR) AF: 0.000279 AC: 9 AN: 32226

American (AMR) AF: 0.00152 AC: 61 AN: 40114

Ashkenazi Jewish (ASJ) AF: 0.00241 AC: 62 AN: 25684

East Asian (EAS) AF: 0.00196 AC: 76 AN: 38778

South Asian (SAS) AF: 0.000140 AC: 12 AN: 85552

European-Finnish (FIN) AF: 0.000190 AC: 10 AN: 52578

Middle Eastern (MID) AF: 0.000350 AC: 2 AN: 5722

European-Non Finnish (NFE) AF: 0.000352 AC: 387 AN: 1098788

Other (OTH) AF: 0.000656 AC: 39 AN: 59466

GnomAD4 genome AF: 0.000661 AC: 96 AN: 145132 Hom.: 0 Cov.: 0 AF XY: 0.000667 AC XY: 47 AN XY: 70474

African (AFR) AF: 0.000568 AC: 22 AN: 38764

American (AMR) AF: 0.00245 AC: 34 AN: 13900

Ashkenazi Jewish (ASJ) AF: 0.000592 AC: 2 AN: 3376

East Asian (EAS) AF: 0.000424 AC: 2 AN: 4722

South Asian (SAS) AF: 0.000226 AC: 1 AN: 4430

European-Finnish (FIN) AF: 0.000298 AC: 3 AN: 10080

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 288

European-Non Finnish (NFE) AF: 0.000420 AC: 28 AN: 66700

Other (OTH) AF: 0.00202 AC: 4 AN: 1984

Alfa AF: 0.00 Hom.: 123

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Benign:1

Oct 14, 2021

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1
Mutation Taster		=156/44	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;