12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr12-6936728-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs60216939
• NM_001940.4:c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001940.4(ATN1):​c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln493_Gln502dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.00045 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00016 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATN1 NM_001940.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.621

Genes affected

ATN1 (HGNC:3033): (atrophin 1) Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 65 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATN1	NM_001940.4	c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	ENST00000396684.3	NP_001931.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATN1	ENST00000396684.3	c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	1	NM_001940.4	ENSP00000379915.2
ATN1	ENST00000356654.8	c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln493_Gln502dup	disruptive_inframe_insertion	Exon 5 of 10	1		ENSP00000349076.3

Frequencies

GnomAD3 genomes AF: 0.000448 AC: 65 AN: 145034 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000207

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000144

Gnomad ASJ AF: 0.000889

Gnomad EAS AF: 0.000634

Gnomad SAS AF: 0.000451

Gnomad FIN AF: 0.000298

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000645

Gnomad OTH AF: 0.000509

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000156 AC: 225 AN: 1438900 Hom.: 0 Cov.: 0 AF XY: 0.000167 AC XY: 120 AN XY: 716718

Gnomad4 AFR exome AF: 0.0000310

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.000350

Gnomad4 EAS exome AF: 0.00119

Gnomad4 SAS exome AF: 0.000304

Gnomad4 FIN exome AF: 0.000152

Gnomad4 NFE exome AF: 0.000109

Gnomad4 OTH exome AF: 0.000252

GnomAD4 genome AF: 0.000448 AC: 65 AN: 145134 Hom.: 0 Cov.: 0 AF XY: 0.000426 AC XY: 30 AN XY: 70474

Gnomad4 AFR AF: 0.000206

Gnomad4 AMR AF: 0.000144

Gnomad4 ASJ AF: 0.000889

Gnomad4 EAS AF: 0.000635

Gnomad4 SAS AF: 0.000451

Gnomad4 FIN AF: 0.000298

Gnomad4 NFE AF: 0.000645

Gnomad4 OTH AF: 0.000504

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Uncertain:1

May 10, 2022

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA (p.Q493_Q502dup) alteration is located in exon 5 (coding exon 4) of the ATN1 gene. The alteration consists of an in-frame duplication of 30 nucleotides from position 1479 to 1508, resulting in the duplication of 10 residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60216939; hg19: chr12-7045891;