chr12-6936728-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_001940.4(ATN1):c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln493_Gln502dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. H503H) has been classified as Uncertain significance.
Frequency
Consequence
NM_001940.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- congenital hypotonia, epilepsy, developmental delay, and digital anomaliesInheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Illumina, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- dentatorubral-pallidoluysian atrophyInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ATN1 | ENST00000396684.3 | c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln493_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | 1 | NM_001940.4 | ENSP00000379915.2 | ||
ATN1 | ENST00000356654.8 | c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln493_Gln502dup | disruptive_inframe_insertion | Exon 5 of 10 | 1 | ENSP00000349076.3 |
Frequencies
GnomAD3 genomes AF: 0.000448 AC: 65AN: 145034Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000156 AC: 225AN: 1438900Hom.: 0 Cov.: 0 AF XY: 0.000167 AC XY: 120AN XY: 716718 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000448 AC: 65AN: 145134Hom.: 0 Cov.: 0 AF XY: 0.000426 AC XY: 30AN XY: 70474 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Inborn genetic diseases Uncertain:1
The c.1479_1508dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA (p.Q493_Q502dup) alteration is located in exon 5 (coding exon 4) of the ATN1 gene. The alteration consists of an in-frame duplication of 30 nucleotides from position 1479 to 1508, resulting in the duplication of 10 residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at