13-40793256-CATTGACCTCACAGCGGGGGCTGCAG-C

Position:

• chr13-40793256-CATTGACCTCACAGCGGGGGCTGCAG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_014252.4(SLC25A15):​c.31_55delATTGACCTCACAGCGGGGGCTGCAG​(p.Ile11fs) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SLC25A15 NM_014252.4 frameshift, splice_region
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.13

Genes affected

SLC25A15 (HGNC:10985): (solute carrier family 25 member 15) This gene is a member of the mitochondrial carrier family. The encoded protein transports ornithine across the inner mitochondrial membrane from the cytosol to the mitochondrial matrix. The protein is an essential component of the urea cycle, and functions in ammonium detoxification and biosynthesis of the amino acid arginine. Mutations in this gene result in hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. There is a pseudogene of this locus on the Y chromosome.[provided by RefSeq, May 2009]

SLC25A15 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-40793256-CATTGACCTCACAGCGGGGGCTGCAG-C is Pathogenic according to our data. Variant chr13-40793256-CATTGACCTCACAGCGGGGGCTGCAG-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2678852.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SLC25A15	NM_014252.4	c.31_55delATTGACCTCACAGCGGGGGCTGCAG	p.Ile11fs	frameshift_variant, splice_region_variant	2/7	ENST00000338625.9	NP_055067.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SLC25A15	ENST00000338625.9	c.31_55delATTGACCTCACAGCGGGGGCTGCAG	p.Ile11fs	frameshift_variant, splice_region_variant	2/7	1	NM_014252.4	ENSP00000342267.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Baylor Genetics

Jun 08, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr13-41367392;