13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCGGCG-AGCG

Variant names:

• chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCG-A
• rs761822481
• NM_007129.5:c.1383_1406delGGCGGCGGCTGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_007129.5(ZIC2):​c.1383_1406delGGCGGCGGCTGCGGCGGCGGCGGC​(p.Ala462_Ala469del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000167 in 1,375,448 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A461A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000017 (0 hom.)
• Consequence: ZIC2 NM_007129.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.97
• Publications: 0 publications found

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ZIC2 Gene-Disease associations (from GenCC):

• holoprosencephaly 5

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, G2P
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007129.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007129.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZIC2	NM_007129.5	MANE Select	c.1383_1406delGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala462_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	NP_009060.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ZIC2	ENST00000376335.8	TSL:1 MANE Select	c.1383_1406delGGCGGCGGCTGCGGCGGCGGCGGC	p.Ala462_Ala469del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000365514.3	O95409
	ZIC2	ENST00000468291.1	TSL:2	n.357_380delGGCGGCGGCTGCGGCGGCGGCGGC		non_coding_transcript_exon	Exon 3 of 3
	ZIC2	ENST00000477213.1	TSL:2	n.465_*15delGGCGGCGGCTGCGGCGGCGGCGGC		splice_region non_coding_transcript_exon	Exon 2 of 2

Frequencies

GnomAD3 genomes AF: 0.0000134 AC: 2 AN: 149586 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000665

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000149

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000171 AC: 21 AN: 1225764 Hom.: 0 AF XY: 0.0000200 AC XY: 12 AN XY: 600920

African (AFR) AF: 0.00 AC: 0 AN: 25248

American (AMR) AF: 0.00 AC: 0 AN: 18246

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19342

East Asian (EAS) AF: 0.00 AC: 0 AN: 29576

South Asian (SAS) AF: 0.00 AC: 0 AN: 45862

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27714

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4760

European-Non Finnish (NFE) AF: 0.0000199 AC: 20 AN: 1005136

Other (OTH) AF: 0.0000200 AC: 1 AN: 49880

GnomAD4 genome AF: 0.0000134 AC: 2 AN: 149684 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 73030

African (AFR) AF: 0.00 AC: 0 AN: 41056

American (AMR) AF: 0.0000664 AC: 1 AN: 15060

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3440

East Asian (EAS) AF: 0.00 AC: 0 AN: 5138

South Asian (SAS) AF: 0.00 AC: 0 AN: 4784

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9720

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.0000149 AC: 1 AN: 67214

Other (OTH) AF: 0.00 AC: 0 AN: 2070

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Holoprosencephaly 5 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.0
Mutation Taster		=151/49	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs761822481; hg19: chr13-100637714;