chr13-99985460-AGCGGCGGCGGCGGCTGCGGCGGCG-A
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3BS2
The NM_007129.5(ZIC2):c.1383_1406delGGCGGCGGCTGCGGCGGCGGCGGC(p.Ala462_Ala469del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000167 in 1,375,448 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_007129.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ZIC2 | NM_007129.5 | c.1383_1406delGGCGGCGGCTGCGGCGGCGGCGGC | p.Ala462_Ala469del | disruptive_inframe_deletion | Exon 3 of 3 | ENST00000376335.8 | NP_009060.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000134 AC: 2AN: 149586Hom.: 0 Cov.: 32
GnomAD4 exome AF: 0.0000171 AC: 21AN: 1225764Hom.: 0 AF XY: 0.0000200 AC XY: 12AN XY: 600920
GnomAD4 genome AF: 0.0000134 AC: 2AN: 149684Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 73030
ClinVar
Submissions by phenotype
Holoprosencephaly 5 Uncertain:1
This variant, c.1383_1406del, results in the deletion of 8 amino acid(s) of the ZIC2 protein (p.Ala463_Ala470del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with ZIC2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at