14-102922746-CACCGGTGCGGGCCCGGACGGT-C

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 4P and 2B. PVS1_ModeratePM2BP6_Moderate

The NM_001425246.1(AMN):​c.-122_-120+18delCCGGTGCGGGCCCGGACGGTA variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

Frequency

Genomes: not found (cov: 33)

Consequence

AMN
NM_001425246.1 splice_donor, splice_region, 5_prime_UTR, intron

Scores

Not classified

Clinical Significance

Likely benign criteria provided, single submitter B:1

Conservation

PhyloP100: 1.57
Variant links:
Genes affected
AMN (HGNC:14604): (amnion associated transmembrane protein) The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.07333333 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.6, offset of 0 (no position change), new splice context is: gcgGTctgt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
BP6
Variant 14-102922746-CACCGGTGCGGGCCCGGACGGT-C is Benign according to our data. Variant chr14-102922746-CACCGGTGCGGGCCCGGACGGT-C is described in ClinVar as [Likely_benign]. Clinvar id is 2855808.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
AMNNM_030943.4 linkc.43+17_43+37delCCGGTGCGGGCCCGGACGGTA intron_variant Intron 1 of 11 ENST00000299155.10 NP_112205.2 Q9BXJ7-1
AMNNM_001425246.1 linkc.-122_-120+18delCCGGTGCGGGCCCGGACGGTA splice_region_variant Exon 1 of 12 NP_001412175.1
AMNNM_001425246.1 linkc.-122_-120+18delCCGGTGCGGGCCCGGACGGTA splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant Exon 1 of 12 NP_001412175.1
AMNNM_001425246.1 linkc.-122_-120+18delCCGGTGCGGGCCCGGACGGTA non_coding_transcript_variant NP_001412175.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
AMNENST00000299155.10 linkc.43+16_43+36delACCGGTGCGGGCCCGGACGGT intron_variant Intron 1 of 11 1 NM_030943.4 ENSP00000299155.6 Q9BXJ7-1
AMNENST00000541086.5 linkn.-175_-155delACCGGTGCGGGCCCGGACGGT upstream_gene_variant 2

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Imerslund-Grasbeck syndrome Benign:1
Sep 27, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely benign
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr14-103389083; API