chr14-102922746-CACCGGTGCGGGCCCGGACGGT-C

Variant names:

• chr14-102922746-CACCGGTGCGGGCCCGGACGGT-C
• NM_030943.4:c.43+17_43+37delCCGGTGCGGGCCCGGACGGTA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 4P and 2B. PVS1_Moderate PM2 BP6_Moderate

The NM_001425246.1(AMN):​c.-122_-120+18delCCGGTGCGGGCCCGGACGGTA variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: AMN NM_001425246.1 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.57

Genes affected

AMN (HGNC:14604): (amnion associated transmembrane protein) The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.07333333 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.6, offset of 0 (no position change), new splice context is: gcgGTctgt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 14-102922746-CACCGGTGCGGGCCCGGACGGT-C is Benign according to our data. Variant chr14-102922746-CACCGGTGCGGGCCCGGACGGT-C is described in ClinVar as [Likely_benign]. Clinvar id is 2855808.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AMN	NM_030943.4	c.43+17_43+37delCCGGTGCGGGCCCGGACGGTA		intron_variant	Intron 1 of 11	ENST00000299155.10	NP_112205.2
AMN	NM_001425246.1	c.-122_-120+18delCCGGTGCGGGCCCGGACGGTA		splice_region_variant	Exon 1 of 12		NP_001412175.1
AMN	NM_001425246.1	c.-122_-120+18delCCGGTGCGGGCCCGGACGGTA		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 12		NP_001412175.1
AMN	NM_001425246.1	c.-122_-120+18delCCGGTGCGGGCCCGGACGGTA		non_coding_transcript_variant			NP_001412175.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AMN	ENST00000299155.10	c.43+16_43+36delACCGGTGCGGGCCCGGACGGT		intron_variant	Intron 1 of 11	1	NM_030943.4	ENSP00000299155.6
AMN	ENST00000541086.5	n.-175_-155delACCGGTGCGGGCCCGGACGGT		upstream_gene_variant		2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Imerslund-Grasbeck syndrome Benign:1

Sep 27, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr14-103389083;