14-28767473-CGCCGCCGCCGCCGCAGCAGCAGCA-CGCCGCCGCCGCCGCAGCAGCAGCAGCCGCCGCCGCCGCAGCAGCAGCA

Position:

• chr14-28767473-CGCCGCCGCCGCCGCAGCAGCAGCA-CGCCGCCGCCGCCGCAGCAGCAGCAGCCGCCGCCGCCGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_005249.5(FOXG1):​c.209_232dupAGCAGCAGCAGCCGCCGCCGCCGC​(p.Gln70_Pro77dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000687 in 145,534 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000069 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000010 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: FOXG1 NM_005249.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.718

Genes affected

FOXG1 (HGNC:3811): (forkhead box G1) This locus encodes a member of the fork-head transcription factor family. The encoded protein, which functions as a transcriptional repressor, is highly expressed in neural tissues during brain development. Mutations at this locus have been associated with Rett syndrome and a diverse spectrum of neurodevelopmental disorders defined as part of the FOXG1 syndrome. This gene is disregulated in many types of cancer and is the target of multiple microRNAs that regulate the proliferation of tumor cells. [provided by RefSeq, Jul 2020]

LINC01551 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FOXG1	NM_005249.5	c.209_232dupAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77dup	disruptive_inframe_insertion	1/1	ENST00000313071.7	NP_005240.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FOXG1	ENST00000313071.7	c.209_232dupAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77dup	disruptive_inframe_insertion	1/1	6	NM_005249.5	ENSP00000339004.3
FOXG1	ENST00000706482.1	c.209_232dupAGCAGCAGCAGCCGCCGCCGCCGC	p.Gln70_Pro77dup	disruptive_inframe_insertion	2/2			ENSP00000516406.1
LINC01551	ENST00000675861.1	n.374+1475_374+1498dupAGCAGCAGCAGCCGCCGCCGCCGC		intron_variant

Frequencies

GnomAD3 genomes AF: 0.00000687 AC: 1 AN: 145534 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000247

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000104 AC: 1 AN: 957124 Hom.: 0 Cov.: 19 AF XY: 0.00 AC XY: 0 AN XY: 463430

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000124

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000687 AC: 1 AN: 145534 Hom.: 0 Cov.: 31 AF XY: 0.0000141 AC XY: 1 AN XY: 70698

Gnomad4 AFR AF: 0.0000247

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726920; hg19: chr14-29236679;