15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGT

Variant names:

• chr15-23646357-GGGGGCCTGGCGGATCACGGGT-G
• rs794726941
• NM_019066.5:c.1365_1385delACCCGTGATCCGCCAGGCCCC

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 2P and 9B. PM4 BP6 BS1 BS2

The NM_019066.5(MAGEL2):​c.1365_1385delACCCGTGATCCGCCAGGCCCC​(p.Pro456_Pro462del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00146 in 1,367,876 control chromosomes in the GnomAD database, including 23 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. P455P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0021 (5 hom., cov: 32)
  • Exomes 𝑓: 0.0014 (18 hom.)
• Consequence: MAGEL2 NM_019066.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:3
• Conservation: PhyloP100: 1.10
• Publications: 1 publications found

Genes affected

MAGEL2 (HGNC:6814): (MAGE family member L2) Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]

MAGEL2 Gene-Disease associations (from GenCC):

• Schaaf-Yang syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Illumina, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -7 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_019066.5.
• BP6: Variant 15-23646357-GGGGGCCTGGCGGATCACGGGT-G is Benign according to our data. Variant chr15-23646357-GGGGGCCTGGCGGATCACGGGT-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 193404.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.00206 (297/143846) while in subpopulation SAS AF = 0.0201 (89/4430). AF 95% confidence interval is 0.0167. There are 5 homozygotes in GnomAd4. There are 163 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.
• BS2: High AC in GnomAd4 at 297 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_019066.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAGEL2	NM_019066.5	MANE Select	c.1365_1385delACCCGTGATCCGCCAGGCCCC	p.Pro456_Pro462del	disruptive_inframe_deletion	Exon 1 of 1	NP_061939.3

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MAGEL2	ENST00000650528.1	MANE Select	c.1365_1385delACCCGTGATCCGCCAGGCCCC	p.Pro456_Pro462del	disruptive_inframe_deletion	Exon 1 of 1	ENSP00000497810.1

Frequencies

GnomAD3 genomes AF: 0.00207 AC: 297 AN: 143776 Hom.: 5 Cov.: 32

Gnomad AFR AF: 0.000392

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000684

Gnomad ASJ AF: 0.00505

Gnomad EAS AF: 0.00126

Gnomad SAS AF: 0.0203

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00365

Gnomad NFE AF: 0.00235

Gnomad OTH AF: 0.00200

GnomAD2 exomes AF: 0.00260 AC: 41 AN: 15782 AF XY: 0.00334

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000353

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000482

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00166

Gnomad OTH exome AF: 0.00192

GnomAD4 exome AF: 0.00139 AC: 1706 AN: 1224030 Hom.: 18 AF XY: 0.00182 AC XY: 1077 AN XY: 592580

African (AFR) AF: 0.000258 AC: 6 AN: 23298

American (AMR) AF: 0.00116 AC: 14 AN: 12064

Ashkenazi Jewish (ASJ) AF: 0.00309 AC: 53 AN: 17128

East Asian (EAS) AF: 0.000521 AC: 15 AN: 28766

South Asian (SAS) AF: 0.0132 AC: 696 AN: 52738

European-Finnish (FIN) AF: 0.000240 AC: 7 AN: 29190

Middle Eastern (MID) AF: 0.00438 AC: 15 AN: 3422

European-Non Finnish (NFE) AF: 0.000784 AC: 789 AN: 1006846

Other (OTH) AF: 0.00219 AC: 111 AN: 50578

GnomAD4 genome AF: 0.00206 AC: 297 AN: 143846 Hom.: 5 Cov.: 32 AF XY: 0.00232 AC XY: 163 AN XY: 70138

African (AFR) AF: 0.000417 AC: 16 AN: 38366

American (AMR) AF: 0.000683 AC: 10 AN: 14634

Ashkenazi Jewish (ASJ) AF: 0.00505 AC: 17 AN: 3366

East Asian (EAS) AF: 0.00126 AC: 6 AN: 4756

South Asian (SAS) AF: 0.0201 AC: 89 AN: 4430

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9762

Middle Eastern (MID) AF: 0.00388 AC: 1 AN: 258

European-Non Finnish (NFE) AF: 0.00235 AC: 154 AN: 65400

Other (OTH) AF: 0.00198 AC: 4 AN: 2024

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	2	3	not provided (5)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs794726941; hg19: chr15-23891504;