15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGT

Position:

• chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGT

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 2P and 9B. PM4 BP6 BS1 BS2

The NM_019066.5(MAGEL2):​c.1365_1385delACCCGTGATCCGCCAGGCCCC​(p.Pro456_Pro462del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00146 in 1,367,876 control chromosomes in the GnomAD database, including 23 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0021 (5 hom., cov: 32)
  • Exomes 𝑓: 0.0014 (18 hom.)
• Consequence: MAGEL2 NM_019066.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:3
• Conservation: PhyloP100: 1.10

Genes affected

MAGEL2 (HGNC:6814): (MAGE family member L2) Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_019066.5.
• BP6: Variant 15-23646357-GGGGGCCTGGCGGATCACGGGT-G is Benign according to our data. Variant chr15-23646357-GGGGGCCTGGCGGATCACGGGT-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 193404.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Uncertain_significance=2, Benign=2}. Variant chr15-23646357-GGGGGCCTGGCGGATCACGGGT-G is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population sas. gnomad4 allele frequency = 0.00206 (297/143846) while in subpopulation SAS AF= 0.0201 (89/4430). AF 95% confidence interval is 0.0167. There are 5 homozygotes in gnomad4. There are 163 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 297 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MAGEL2	NM_019066.5	c.1365_1385delACCCGTGATCCGCCAGGCCCC	p.Pro456_Pro462del	disruptive_inframe_deletion	1/1	ENST00000650528.1	NP_061939.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MAGEL2	ENST00000650528.1	c.1365_1385delACCCGTGATCCGCCAGGCCCC	p.Pro456_Pro462del	disruptive_inframe_deletion	1/1		NM_019066.5	ENSP00000497810.1

Frequencies

GnomAD3 genomes AF: 0.00207 AC: 297 AN: 143776 Hom.: 5 Cov.: 32

Gnomad AFR AF: 0.000392

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000684

Gnomad ASJ AF: 0.00505

Gnomad EAS AF: 0.00126

Gnomad SAS AF: 0.0203

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00365

Gnomad NFE AF: 0.00235

Gnomad OTH AF: 0.00200

GnomAD3 exomes AF: 0.00260 AC: 41 AN: 15782 Hom.: 0 AF XY: 0.00334 AC XY: 26 AN XY: 7780

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000353

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000482

Gnomad SAS exome AF: 0.0165

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00166

Gnomad OTH exome AF: 0.00192

GnomAD4 exome AF: 0.00139 AC: 1706 AN: 1224030 Hom.: 18 AF XY: 0.00182 AC XY: 1077 AN XY: 592580

Gnomad4 AFR exome AF: 0.000258

Gnomad4 AMR exome AF: 0.00116

Gnomad4 ASJ exome AF: 0.00309

Gnomad4 EAS exome AF: 0.000521

Gnomad4 SAS exome AF: 0.0132

Gnomad4 FIN exome AF: 0.000240

Gnomad4 NFE exome AF: 0.000784

Gnomad4 OTH exome AF: 0.00219

GnomAD4 genome AF: 0.00206 AC: 297 AN: 143846 Hom.: 5 Cov.: 32 AF XY: 0.00232 AC XY: 163 AN XY: 70138

Gnomad4 AFR AF: 0.000417

Gnomad4 AMR AF: 0.000683

Gnomad4 ASJ AF: 0.00505

Gnomad4 EAS AF: 0.00126

Gnomad4 SAS AF: 0.0201

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00235

Gnomad4 OTH AF: 0.00198

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:2 Benign:3

Uncertain significance, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Jan 18, 2017	- -
Uncertain significance, criteria provided, single submitter	clinical testing	Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics	Mar 07, 2017	- -
Benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 23, 2024	- -
Benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Nov 01, 2024	MAGEL2: BS1, BS2 -
Likely benign, criteria provided, single submitter	clinical testing	GeneDx	Oct 05, 2018	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726941; hg19: chr15-23891504;