rs794726941

Positions:

• chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-G
• chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGT
• chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT
• chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2 PM4 BP6

The NM_019066.5(MAGEL2):​c.1344_1385delACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCC​(p.Pro449_Pro462del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000696 in 143,778 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0000070 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000049 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MAGEL2 NM_019066.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: 1.10

Genes affected

MAGEL2 (HGNC:6814): (MAGE family member L2) Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_019066.5.
• BP6: Variant 15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-G is Benign according to our data. Variant chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 2637295.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Uncertain_significance=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MAGEL2	NM_019066.5	c.1344_1385delACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCC	p.Pro449_Pro462del	disruptive_inframe_deletion	1/1	ENST00000650528.1	NP_061939.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MAGEL2	ENST00000650528.1	c.1344_1385delACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCC	p.Pro449_Pro462del	disruptive_inframe_deletion	1/1		NM_019066.5	ENSP00000497810.1

Frequencies

GnomAD3 genomes AF: 0.00000696 AC: 1 AN: 143778 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000153

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000490 AC: 6 AN: 1224066 Hom.: 0 AF XY: 0.00000169 AC XY: 1 AN XY: 592596

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000829

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000397

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000696 AC: 1 AN: 143778 Hom.: 0 Cov.: 32 AF XY: 0.0000143 AC XY: 1 AN XY: 70052

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000153

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

MAGEL2-related disorder Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

Sep 21, 2022

The MAGEL2 c.1344_1385del42 variant is predicted to result in an in-frame deletion (p.Pro449_Pro462del). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.0069% of alleles in individuals of European (Non-Finnish) descent in gnomAD (http://gnomad.broadinstitute.org/variant/15-23891504-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-G). At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Apr 04, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726941; hg19: chr15-23891504;