15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT

Position:

• chr15-23646357-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT-GGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGTGGGGCCTGGCGGATCACGGGT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_019066.5(MAGEL2):​c.1344_1385dupACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCC​(p.Pro462_Ala463insProValIleArgGlnAlaProProValIleArgGlnAlaPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000696 in 143,778 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000070 (0 hom., cov: 32)
  • Exomes 𝑓: 8.2e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MAGEL2 NM_019066.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.10

Genes affected

MAGEL2 (HGNC:6814): (MAGE family member L2) Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_019066.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MAGEL2	NM_019066.5	c.1344_1385dupACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCC	p.Pro462_Ala463insProValIleArgGlnAlaProProValIleArgGlnAlaPro	disruptive_inframe_insertion	1/1	ENST00000650528.1	NP_061939.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MAGEL2	ENST00000650528.1	c.1344_1385dupACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCC	p.Pro462_Ala463insProValIleArgGlnAlaProProValIleArgGlnAlaPro	disruptive_inframe_insertion	1/1		NM_019066.5	ENSP00000497810.1

Frequencies

GnomAD3 genomes AF: 0.00000696 AC: 1 AN: 143778 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000297

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 8.17e-7 AC: 1 AN: 1224070 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 592598

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000348

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000696 AC: 1 AN: 143778 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 70052

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.000297

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726941; hg19: chr15-23891504;