15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_ModeratePM2PP5_Very_Strong
The NM_002225.5(IVD):c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA(p.Arg410fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Genomes: not found (cov: 32)
Consequence
IVD
NM_002225.5 frameshift
NM_002225.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 10.0
Genes affected
IVD (HGNC:6186): (isovaleryl-CoA dehydrogenase) Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0338 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is Pathogenic according to our data. Variant chr15-40418218-GAGGCGGCTGGTCATCGGCAGAGCCTTCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 551276.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
IVD | NM_002225.5 | c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA | p.Arg410fs | frameshift_variant | 12/12 | ENST00000487418.8 | NP_002216.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
IVD | ENST00000487418.8 | c.1229_1256delGGCGGCTGGTCATCGGCAGAGCCTTCAA | p.Arg410fs | frameshift_variant | 12/12 | 1 | NM_002225.5 | ENSP00000418397.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Isovaleryl-CoA dehydrogenase deficiency Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Dec 09, 2023 | This sequence change results in a frameshift in the IVD gene (p.Arg413Metfs*24). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 14 amino acid(s) of the IVD protein and extend the protein by 9 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with IVD-related conditions. ClinVar contains an entry for this variant (Variation ID: 551276). This variant disrupts a region of the IVD protein in which other variant(s) (p.Arg414Trp) have been determined to be pathogenic (PMID: 25220015; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Counsyl | Mar 28, 2017 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at