15-48412619-GTTTGGGGTAGCCATTGATCT-G

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5

The NM_000138.5(FBN1):​c.8156_8175delAGATCAATGGCTACCCCAAA​(p.Lys2719ThrfsTer12) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. K2719K) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

FBN1
NM_000138.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 8.02

Publications

1 publications found
Variant links:
Genes affected
FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]
FBN1 Gene-Disease associations (from GenCC):
  • familial thoracic aortic aneurysm and aortic dissection
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • Marfan syndrome
    Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P, PanelApp Australia, Orphanet, Ambry Genetics
  • Acromicric dysplasia
    Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
  • progeroid and marfanoid aspect-lipodystrophy syndrome
    Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
  • stiff skin syndrome
    Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • Weill-Marchesani syndrome 2, dominant
    Inheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
  • geleophysic dysplasia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • isolated ectopia lentis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • neonatal Marfan syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Weill-Marchesani syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • ectopia lentis 1, isolated, autosomal dominant
    Inheritance: AD Classification: LIMITED Submitted by: G2P
  • Shprintzen-Goldberg syndrome
    Inheritance: AD, Unknown Classification: LIMITED, NO_KNOWN Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 99 pathogenic variants in the truncated region.
PP5
Variant 15-48412619-GTTTGGGGTAGCCATTGATCT-G is Pathogenic according to our data. Variant chr15-48412619-GTTTGGGGTAGCCATTGATCT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 40244.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
FBN1NM_000138.5 linkc.8156_8175delAGATCAATGGCTACCCCAAA p.Lys2719ThrfsTer12 frameshift_variant Exon 65 of 66 ENST00000316623.10 NP_000129.3
FBN1NM_001406716.1 linkc.8156_8175delAGATCAATGGCTACCCCAAA p.Lys2719ThrfsTer12 frameshift_variant Exon 64 of 65 NP_001393645.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
FBN1ENST00000316623.10 linkc.8156_8175delAGATCAATGGCTACCCCAAA p.Lys2719ThrfsTer12 frameshift_variant Exon 65 of 66 1 NM_000138.5 ENSP00000325527.5

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Progeroid and marfanoid aspect-lipodystrophy syndrome Pathogenic:1
Apr 01, 2011
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.0
Mutation Taster
=13/187
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs398122832; hg19: chr15-48704816; API