15-48487125-CACTGATACTTCCCTATGAGGT-C
Position:
Variant summary
Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1PM2PM4PP3PP5_Moderate
The NM_000138.5(FBN1):c.3518_3538delACCTCATAGGGAAGTATCAGT(p.Asn1173_Cys1180delinsSer) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Genomes: not found (cov: 32)
Consequence
FBN1
NM_000138.5 disruptive_inframe_deletion
NM_000138.5 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.01
Genes affected
FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 9 ACMG points.
PM1
In a domain EGF-like 18; calcium-binding (size 41) in uniprot entity FBN1_HUMAN there are 11 pathogenic changes around while only 4 benign (73%) in NM_000138.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000138.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 15-48487125-CACTGATACTTCCCTATGAGGT-C is Pathogenic according to our data. Variant chr15-48487125-CACTGATACTTCCCTATGAGGT-C is described in ClinVar as [Pathogenic]. Clinvar id is 527215.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
FBN1 | NM_000138.5 | c.3518_3538delACCTCATAGGGAAGTATCAGT | p.Asn1173_Cys1180delinsSer | disruptive_inframe_deletion | 29/66 | ENST00000316623.10 | NP_000129.3 | |
FBN1 | NM_001406716.1 | c.3518_3538delACCTCATAGGGAAGTATCAGT | p.Asn1173_Cys1180delinsSer | disruptive_inframe_deletion | 28/65 | NP_001393645.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
FBN1 | ENST00000316623.10 | c.3518_3538delACCTCATAGGGAAGTATCAGT | p.Asn1173_Cys1180delinsSer | disruptive_inframe_deletion | 29/66 | 1 | NM_000138.5 | ENSP00000325527.5 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Marfan syndrome;C4707243:Familial thoracic aortic aneurysm and aortic dissection Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jul 14, 2023 | This variant, c.3518_3538del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the FBN1 protein (p.Asn1173_Cys1180delinsSer). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with Marfan syndrome (Invitae). ClinVar contains an entry for this variant (Variation ID: 527215). This variant affects a cysteine residue in the EGF-like, TGFBP or hybrid motif domains of FBN1. Cysteine residues are believed to be involved in intramolecular disulfide bridges and have been shown to be important for FBN1 protein structure (PMID: 16905551, 19349279). In addition, missense substitutions affecting cysteine residues within these domains are significantly overrepresented among patients with Marfan syndrome (PMID: 16571647, 17701892). This variant disrupts a region of the FBN1 protein in which other variant(s) (p.Asn1173Ile) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at