rs1555398514

Variant names:

• chr15-48487125-CACTGATACTTCCCTATGAGGT-C
• rs1555398514
• NM_000138.5:c.3518_3538delACCTCATAGGGAAGTATCAGT

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1 PM2 PM4 PP3 PP5_Moderate

The NM_000138.5(FBN1):​c.3518_3538delACCTCATAGGGAAGTATCAGT​(p.Asn1173_Cys1180delinsSer) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: FBN1 NM_000138.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.01

Genes affected

FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM1: In a domain EGF-like 18; calcium-binding (size 41) in uniprot entity FBN1_HUMAN there are 11 pathogenic changes around while only 4 benign (73%) in NM_000138.5
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000138.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 15-48487125-CACTGATACTTCCCTATGAGGT-C is Pathogenic according to our data. Variant chr15-48487125-CACTGATACTTCCCTATGAGGT-C is described in ClinVar as [Pathogenic]. Clinvar id is 527215.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FBN1	NM_000138.5	c.3518_3538delACCTCATAGGGAAGTATCAGT	p.Asn1173_Cys1180delinsSer	disruptive_inframe_deletion	Exon 29 of 66	ENST00000316623.10	NP_000129.3
FBN1	NM_001406716.1	c.3518_3538delACCTCATAGGGAAGTATCAGT	p.Asn1173_Cys1180delinsSer	disruptive_inframe_deletion	Exon 28 of 65		NP_001393645.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FBN1	ENST00000316623.10	c.3518_3538delACCTCATAGGGAAGTATCAGT	p.Asn1173_Cys1180delinsSer	disruptive_inframe_deletion	Exon 29 of 66	1	NM_000138.5	ENSP00000325527.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Marfan syndrome;C4707243:Familial thoracic aortic aneurysm and aortic dissection Pathogenic:1

Mar 16, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.3518_3538del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the FBN1 protein (p.Asn1173_Cys1180delinsSer). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with Marfan syndrome (Invitae). ClinVar contains an entry for this variant (Variation ID: 527215). This variant affects a cysteine residue in the EGF-like, TGFBP or hybrid motif domains of FBN1. Cysteine residues are believed to be involved in intramolecular disulfide bridges and have been shown to be important for FBN1 protein structure (PMID: 16905551, 19349279). In addition, missense substitutions affecting cysteine residues within these domains are significantly overrepresented among patients with Marfan syndrome (PMID: 16571647, 17701892). This variant disrupts a region of the FBN1 protein in which other variant(s) (p.Asn1173Ile) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555398514; hg19: chr15-48779322;