rs1555398514

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1PM2PM4PP3PP5_Moderate

The NM_000138.5(FBN1):​c.3518_3538delACCTCATAGGGAAGTATCAGT​(p.Asn1173_Cys1180delinsSer) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

FBN1
NM_000138.5 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.01
Variant links:
Genes affected
FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

PM1
In a domain EGF-like 18; calcium-binding (size 41) in uniprot entity FBN1_HUMAN there are 11 pathogenic changes around while only 4 benign (73%) in NM_000138.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000138.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 15-48487125-CACTGATACTTCCCTATGAGGT-C is Pathogenic according to our data. Variant chr15-48487125-CACTGATACTTCCCTATGAGGT-C is described in ClinVar as [Pathogenic]. Clinvar id is 527215.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
FBN1NM_000138.5 linkuse as main transcriptc.3518_3538delACCTCATAGGGAAGTATCAGT p.Asn1173_Cys1180delinsSer disruptive_inframe_deletion 29/66 ENST00000316623.10 NP_000129.3 P35555
FBN1NM_001406716.1 linkuse as main transcriptc.3518_3538delACCTCATAGGGAAGTATCAGT p.Asn1173_Cys1180delinsSer disruptive_inframe_deletion 28/65 NP_001393645.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
FBN1ENST00000316623.10 linkuse as main transcriptc.3518_3538delACCTCATAGGGAAGTATCAGT p.Asn1173_Cys1180delinsSer disruptive_inframe_deletion 29/661 NM_000138.5 ENSP00000325527.5 P35555

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Marfan syndrome;C4707243:Familial thoracic aortic aneurysm and aortic dissection Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJul 14, 2023This variant, c.3518_3538del, is a complex sequence change that results in the deletion of 8 and insertion of 1 amino acid(s) in the FBN1 protein (p.Asn1173_Cys1180delinsSer). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with Marfan syndrome (Invitae). ClinVar contains an entry for this variant (Variation ID: 527215). This variant affects a cysteine residue in the EGF-like, TGFBP or hybrid motif domains of FBN1. Cysteine residues are believed to be involved in intramolecular disulfide bridges and have been shown to be important for FBN1 protein structure (PMID: 16905551, 19349279). In addition, missense substitutions affecting cysteine residues within these domains are significantly overrepresented among patients with Marfan syndrome (PMID: 16571647, 17701892). This variant disrupts a region of the FBN1 protein in which other variant(s) (p.Asn1173Ile) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555398514; hg19: chr15-48779322; API