15-65076794-GCCTCCGCCCGGCCAGCTCGCCATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCCGACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATGCGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCCACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAGGCCGTGGAGTGCGCCGCCTTCCTC-G

Position:

• chr15-65076794-GCCTCCGCCCGGCCAGCTCGCCATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCCGACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATGCGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCCACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAGGCCGTGGAGTGCGCCGCCTTCCTC-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_001101362.3(KBTBD13):​c.-20_265del variant causes a start lost, 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KBTBD13 NM_001101362.3 start_lost, 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.73

Genes affected

KBTBD13 (HGNC:37227): (kelch repeat and BTB domain containing 13) The gene belongs to a family of genes encoding proteins containing a BTB domain and several kelch repeats. The BTB domain functions as a protein-protein interaction module, which includes an ability to self-associate or to interact with non-BTB domain-containing proteins. The kelch motif typically occurs in groups of five to seven repeats, and has been found in proteins with diverse functions. Known functions of these family members include transcription regulation, ion channel tetramerization and gating, protein ubiquitination or degradation, and cytoskeleton regulation. The exact function of this family member has yet to be determined. [provided by RefSeq, Jun 2010]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KBTBD13	NM_001101362.3	c.-20_265del		start_lost, 5_prime_UTR_variant	1/1	ENST00000432196.5	NP_001094832.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KBTBD13	ENST00000432196.5	c.-20_265del		start_lost, 5_prime_UTR_variant	1/1		NM_001101362.3	ENSP00000388723	P1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Nemaline myopathy 6 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 09, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with KBTBD13-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the KBTBD13 mRNA. The next in-frame methionine is located at codon 346. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2086974277; hg19: chr15-65369132;