chr15-65076794-GCCTCCGCCCGGCCAGCTCGCCATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCCGACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATGCGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCCACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAGGCCGTGGAGTGCGCCGCCTTCCTC-G
- chr15-65076794-GCCTCCGCCCGGCCAGCTCGCCATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCCGACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATGCGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCCACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAGGCCGTGGAGTGCGCCGCCTTCCTC-G
- rs2086974277
- NM_001101362.3:c.-20_265del
Variant summary
Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PVS1_SupportingPM2
The NM_001101362.3(KBTBD13):c.-20_265del(p.Met1_Gln89del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001101362.3 start_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 3 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
KBTBD13 | NM_001101362.3 | c.-20_265del | p.Met1_Gln89del | start_lost, conservative_inframe_deletion | Exon 1 of 1 | ENST00000432196.5 | NP_001094832.1 | |
KBTBD13 | NM_001101362.3 | c.-20_265del | 5_prime_UTR_variant | Exon 1 of 1 | ENST00000432196.5 | NP_001094832.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
KBTBD13 | ENST00000432196.5 | c.-20_265del | p.Met1_Gln89del | start_lost, conservative_inframe_deletion | Exon 1 of 1 | 6 | NM_001101362.3 | ENSP00000388723.2 | ||
KBTBD13 | ENST00000432196 | c.-20_265del | 5_prime_UTR_variant | Exon 1 of 1 | NM_001101362.3 | ENSP00000388723.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Nemaline myopathy 6 Uncertain:1
This sequence change affects the initiator methionine of the KBTBD13 mRNA. The next in-frame methionine is located at codon 346. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KBTBD13-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at