15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_002693.3(POLG):​c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC​(p.Gln48_Gln55dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000199 in 150,930 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. P56P) has been classified as Likely benign.

Frequency

Genomes: 𝑓 0.000020 ( 0 hom., cov: 34)
Exomes 𝑓: 0.000019 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

POLG
NM_002693.3 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Likely benign criteria provided, single submitter B:1

Conservation

PhyloP100: 0.406

Publications

0 publications found
Variant links:
Genes affected
POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_benign. The variant received -2 ACMG points.

BP6
Variant 15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT is described in ClinVar as Likely_benign. ClinVar VariationId is 528387.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
POLGNM_002693.3 linkc.143_166dupAGCAGCAGCAGCAGCAACAGCAGC p.Gln48_Gln55dup conservative_inframe_insertion Exon 2 of 23 ENST00000268124.11 NP_002684.1 P54098E5KNU5
POLGNM_001126131.2 linkc.143_166dupAGCAGCAGCAGCAGCAACAGCAGC p.Gln48_Gln55dup conservative_inframe_insertion Exon 2 of 23 NP_001119603.1 P54098E5KNU5
POLGARFNM_001430120.1 linkc.198_221dupAGCAGCAGCAGCAGCAACAGCAGC p.Ala74_Ser75insAlaAlaAlaAlaAlaThrAlaAla disruptive_inframe_insertion Exon 1 of 2 NP_001417049.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
POLGENST00000268124.11 linkc.143_166dupAGCAGCAGCAGCAGCAACAGCAGC p.Gln48_Gln55dup conservative_inframe_insertion Exon 2 of 23 1 NM_002693.3 ENSP00000268124.5 P54098
POLGARFENST00000706918.1 linkc.198_221dupAGCAGCAGCAGCAGCAACAGCAGC p.Ala74_Ser75insAlaAlaAlaAlaAlaThrAlaAla disruptive_inframe_insertion Exon 1 of 2 ENSP00000516626.1 A0A3B3IS91

Frequencies

GnomAD3 genomes
AF:
0.0000199
AC:
3
AN:
150930
Hom.:
0
Cov.:
34
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.0000443
Gnomad OTH
AF:
0.00
GnomAD2 exomes
AF:
0.0000210
AC:
5
AN:
238304
AF XY:
0.0000230
show subpopulations
Gnomad AFR exome
AF:
0.00
Gnomad AMR exome
AF:
0.00
Gnomad ASJ exome
AF:
0.00
Gnomad EAS exome
AF:
0.00
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.0000469
Gnomad OTH exome
AF:
0.00
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.0000193
AC:
28
AN:
1453804
Hom.:
0
Cov.:
32
AF XY:
0.0000180
AC XY:
13
AN XY:
723472
show subpopulations
⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.00
AC:
0
AN:
33038
American (AMR)
AF:
0.00
AC:
0
AN:
44464
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
26034
East Asian (EAS)
AF:
0.00
AC:
0
AN:
39642
South Asian (SAS)
AF:
0.00
AC:
0
AN:
86010
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
50028
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
5750
European-Non Finnish (NFE)
AF:
0.0000244
AC:
27
AN:
1108814
Other (OTH)
AF:
0.0000167
AC:
1
AN:
60024
⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.396
Heterozygous variant carriers
0
2
3
5
6
8
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.0000199
AC:
3
AN:
150930
Hom.:
0
Cov.:
34
AF XY:
0.0000136
AC XY:
1
AN XY:
73722
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
40584
American (AMR)
AF:
0.00
AC:
0
AN:
15198
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3466
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5198
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4806
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10586
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
316
European-Non Finnish (NFE)
AF:
0.0000443
AC:
3
AN:
67788
Other (OTH)
AF:
0.00
AC:
0
AN:
2076
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.592
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
Alfa
AF:
0.0000480
Hom.:
0

ClinVar

Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Progressive sclerosing poliodystrophy Benign:1
Nov 06, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.41
Mutation Taster
=84/16
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555454325; hg19: chr15-89876819; API