rs1555454325
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_002693.3(POLG):c.143_166delAGCAGCAGCAGCAGCAACAGCAGC(p.Gln48_Gln55del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_002693.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLG | NM_002693.3 | c.143_166delAGCAGCAGCAGCAGCAACAGCAGC | p.Gln48_Gln55del | disruptive_inframe_deletion | Exon 2 of 23 | ENST00000268124.11 | NP_002684.1 | |
POLG | NM_001126131.2 | c.143_166delAGCAGCAGCAGCAGCAACAGCAGC | p.Gln48_Gln55del | disruptive_inframe_deletion | Exon 2 of 23 | NP_001119603.1 | ||
POLGARF | NM_001430120.1 | c.198_221delAGCAGCAGCAGCAGCAACAGCAGC | p.Ala67_Ala74del | disruptive_inframe_deletion | Exon 1 of 2 | NP_001417049.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
POLG | ENST00000268124.11 | c.143_166delAGCAGCAGCAGCAGCAACAGCAGC | p.Gln48_Gln55del | disruptive_inframe_deletion | Exon 2 of 23 | 1 | NM_002693.3 | ENSP00000268124.5 | ||
POLGARF | ENST00000706918.1 | c.198_221delAGCAGCAGCAGCAGCAACAGCAGC | p.Ala67_Ala74del | disruptive_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 genome Cov.: 30
ClinVar
Submissions by phenotype
Progressive sclerosing poliodystrophy Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with POLG-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.143_166del, results in the deletion of 8 amino acid(s) of the POLG protein (p.Gln48_Gln55del), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at