chr15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT

Variant names:

• chr15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT
• rs1555454325
• NM_002693.3:c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_002693.3(POLG):​c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC​(p.Gln48_Gln55dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000199 in 150,930 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. P56P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 34)
  • Exomes 𝑓: 0.000019 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLG NM_002693.3 conservative_inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.406
• Publications: 0 publications found

Genes affected

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT is described in ClinVar as Likely_benign. ClinVar VariationId is 528387.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLG	NM_002693.3	c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55dup	conservative_inframe_insertion	Exon 2 of 23	ENST00000268124.11	NP_002684.1
POLG	NM_001126131.2	c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55dup	conservative_inframe_insertion	Exon 2 of 23		NP_001119603.1
POLGARF	NM_001430120.1	c.198_221dupAGCAGCAGCAGCAGCAACAGCAGC	p.Ala74_Ser75insAlaAlaAlaAlaAlaThrAlaAla	disruptive_inframe_insertion	Exon 1 of 2		NP_001417049.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLG	ENST00000268124.11	c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55dup	conservative_inframe_insertion	Exon 2 of 23	1	NM_002693.3	ENSP00000268124.5
POLGARF	ENST00000706918.1	c.198_221dupAGCAGCAGCAGCAGCAACAGCAGC	p.Ala74_Ser75insAlaAlaAlaAlaAlaThrAlaAla	disruptive_inframe_insertion	Exon 1 of 2			ENSP00000516626.1

Frequencies

GnomAD3 genomes AF: 0.0000199 AC: 3 AN: 150930 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000443

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000210 AC: 5 AN: 238304 AF XY: 0.0000230

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000469

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000193 AC: 28 AN: 1453804 Hom.: 0 Cov.: 32 AF XY: 0.0000180 AC XY: 13 AN XY: 723472

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33038

American (AMR) AF: 0.00 AC: 0 AN: 44464

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26034

East Asian (EAS) AF: 0.00 AC: 0 AN: 39642

South Asian (SAS) AF: 0.00 AC: 0 AN: 86010

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50028

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5750

European-Non Finnish (NFE) AF: 0.0000244 AC: 27 AN: 1108814

Other (OTH) AF: 0.0000167 AC: 1 AN: 60024

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000199 AC: 3 AN: 150930 Hom.: 0 Cov.: 34 AF XY: 0.0000136 AC XY: 1 AN XY: 73722

African (AFR) AF: 0.00 AC: 0 AN: 40584

American (AMR) AF: 0.00 AC: 0 AN: 15198

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4806

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10586

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000443 AC: 3 AN: 67788

Other (OTH) AF: 0.00 AC: 0 AN: 2076

Alfa AF: 0.0000480 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Progressive sclerosing poliodystrophy Benign:1

Nov 06, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.41
Mutation Taster		=84/16	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555454325; hg19: chr15-89876819;