15-89333588-GGCTGCTGTTGCTGCTGCTGCTGCT-G

Variant names:

• chr15-89333588-GGCTGCTGTTGCTGCTGCTGCTGCT-G
• rs1555454325
• NM_002693.3:c.143_166delAGCAGCAGCAGCAGCAACAGCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002693.3(POLG):​c.143_166delAGCAGCAGCAGCAGCAACAGCAGC​(p.Gln48_Gln55del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 30)
• Consequence: POLG NM_002693.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.58
• Publications: 0 publications found

Genes affected

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002693.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLG	NM_002693.3	MANE Select	c.143_166delAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55del	disruptive_inframe_deletion	Exon 2 of 23	NP_002684.1	P54098
	POLGARF	NM_001430120.1	MANE Select	c.198_221delAGCAGCAGCAGCAGCAACAGCAGC	p.Ala67_Ala74del	disruptive_inframe_deletion	Exon 1 of 2	NP_001417049.1	A0A3B3IS91
	POLG	NM_001126131.2		c.143_166delAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55del	disruptive_inframe_deletion	Exon 2 of 23	NP_001119603.1	P54098

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	POLG	ENST00000268124.11	TSL:1 MANE Select	c.143_166delAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55del	disruptive_inframe_deletion	Exon 2 of 23	ENSP00000268124.5	P54098
	POLGARF	ENST00000706918.1	MANE Select	c.198_221delAGCAGCAGCAGCAGCAACAGCAGC	p.Ala67_Ala74del	disruptive_inframe_deletion	Exon 1 of 2	ENSP00000516626.1	A0A3B3IS91
	POLG	ENST00000442287.6	TSL:1	c.143_166delAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55del	disruptive_inframe_deletion	Exon 2 of 23	ENSP00000399851.2	P54098

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Progressive sclerosing poliodystrophy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555454325; hg19: chr15-89876819;