15-89333588-GGCTGCTGTTGCTGCTGCTGCTGCT-GGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCT

Variant names:

• chr15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT
• rs1555454325
• NM_002693.3:c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_002693.3(POLG):​c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC​(p.Gln48_Gln55dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000199 in 150,930 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. P56P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 34)
  • Exomes 𝑓: 0.000019 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLG NM_002693.3 conservative_inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.406

Genes affected

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr15-89333588-G-GGCTGCTGTTGCTGCTGCTGCTGCT is described in ClinVar as [Likely_benign]. Clinvar id is 528387.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLG	NM_002693.3	c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55dup	conservative_inframe_insertion	Exon 2 of 23	ENST00000268124.11	NP_002684.1
POLG	NM_001126131.2	c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55dup	conservative_inframe_insertion	Exon 2 of 23		NP_001119603.1
POLGARF	NM_001430120.1	c.198_221dupAGCAGCAGCAGCAGCAACAGCAGC	p.Ala74_Ser75insAlaAlaAlaAlaAlaThrAlaAla	disruptive_inframe_insertion	Exon 1 of 2		NP_001417049.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLG	ENST00000268124.11	c.143_166dupAGCAGCAGCAGCAGCAACAGCAGC	p.Gln48_Gln55dup	conservative_inframe_insertion	Exon 2 of 23	1	NM_002693.3	ENSP00000268124.5
POLGARF	ENST00000706918.1	c.198_221dupAGCAGCAGCAGCAGCAACAGCAGC	p.Ala74_Ser75insAlaAlaAlaAlaAlaThrAlaAla	disruptive_inframe_insertion	Exon 1 of 2			ENSP00000516626.1

Frequencies

GnomAD3 genomes AF: 0.0000199 AC: 3 AN: 150930 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000443

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000210 AC: 5 AN: 238304 Hom.: 0 AF XY: 0.0000230 AC XY: 3 AN XY: 130694

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000469

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000193 AC: 28 AN: 1453804 Hom.: 0 Cov.: 32 AF XY: 0.0000180 AC XY: 13 AN XY: 723472

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000244

Gnomad4 OTH exome AF: 0.0000167

GnomAD4 genome AF: 0.0000199 AC: 3 AN: 150930 Hom.: 0 Cov.: 34 AF XY: 0.0000136 AC XY: 1 AN XY: 73722

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000443

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Progressive sclerosing poliodystrophy Benign:1

Nov 06, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555454325; hg19: chr15-89876819;