16-176724-TGTCTCCTGCCGACAAGACCAAC-T

Variant names:

• chr16-176724-TGTCTCCTGCCGACAAGACCAAC-T
• NM_000558.5:c.12_33delTCCTGCCGACAAGACCAACGTC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_000558.5(HBA1):​c.12_33delTCCTGCCGACAAGACCAACGTC​(p.Pro5ArgfsTer38) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 28)
• Consequence: HBA1 NM_000558.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.85

Genes affected

HBA1 (HGNC:4823): (hemoglobin subunit alpha 1) The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.972 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-176724-TGTCTCCTGCCGACAAGACCAAC-T is Pathogenic according to our data. Variant chr16-176724-TGTCTCCTGCCGACAAGACCAAC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3766565.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HBA1	NM_000558.5	c.12_33delTCCTGCCGACAAGACCAACGTC	p.Pro5ArgfsTer38	frameshift_variant	Exon 1 of 3	ENST00000320868.9	NP_000549.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HBA1	ENST00000320868.9	c.12_33delTCCTGCCGACAAGACCAACGTC	p.Pro5ArgfsTer38	frameshift_variant	Exon 1 of 3	1	NM_000558.5	ENSP00000322421.5

Frequencies

GnomAD3 genomes Cov.: 28

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 28

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Apr 15, 2024

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The HBA1 c.12_33del; p.Pro5ArgfsTer38, (also known as Pro4fs when numbered from the mature protein) to our knowledge, is not reported in the medical literature or gene specific databases. This variant is also absent from the Genome Aggregation Database, indicating it is not a common polymorphism. This variant causes a frameshift by deleting twenty-two nucleotides, so it is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on available information, this variant is considered to be likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-226723;