NM_000558.5:c.12_33delTCCTGCCGACAAGACCAACGTC

Variant names:

• chr16-176724-TGTCTCCTGCCGACAAGACCAAC-T
• NM_000558.5:c.12_33delTCCTGCCGACAAGACCAACGTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000558.5(HBA1):​c.12_33delTCCTGCCGACAAGACCAACGTC​(p.Pro5ArgfsTer38) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 28)
• Consequence: HBA1 NM_000558.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.85
• Publications: 0 publications found

Genes affected

HBA1 (HGNC:4823): (hemoglobin subunit alpha 1) The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]

HBA1 Gene-Disease associations (from GenCC):

• HBA1-related alpha thalassemia spectrum

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• alpha thalassemia spectrum

  Inheritance: SD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• erythrocytosis, familial, 7

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, ClinGen
• unstable hemoglobin disease

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• hemoglobin M disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Hb Bart's hydrops fetalis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hemoglobin H disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• methemoglobinemia, alpha type

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• Heinz body anemia

  Inheritance: AR Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000294436 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 47 pathogenic variants in the truncated region.
• PP5: Variant 16-176724-TGTCTCCTGCCGACAAGACCAAC-T is Pathogenic according to our data. Variant chr16-176724-TGTCTCCTGCCGACAAGACCAAC-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3766565.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000558.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HBA1	NM_000558.5	MANE Select	c.12_33delTCCTGCCGACAAGACCAACGTC	p.Pro5ArgfsTer38	frameshift	Exon 1 of 3	NP_000549.1	P69905

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HBA1	ENST00000320868.9	TSL:1 MANE Select	c.12_33delTCCTGCCGACAAGACCAACGTC	p.Pro5ArgfsTer38	frameshift	Exon 1 of 3	ENSP00000322421.5	P69905
	HBA1	ENST00000472694.1	TSL:1	n.31_52delTCCTGCCGACAAGACCAACGTC		non_coding_transcript_exon	Exon 1 of 2
	HBA1	ENST00000487791.1	TSL:1	n.-20_2delTCCTGCCGACAAGACCAACGTC		non_coding_transcript_exon	Exon 1 of 2

Frequencies

GnomAD3 genomes Cov.: 28

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 28

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr16-226723;