chr16-176724-TGTCTCCTGCCGACAAGACCAAC-T
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000558.5(HBA1):c.12_33delTCCTGCCGACAAGACCAACGTC(p.Pro5ArgfsTer38) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_000558.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- HBA1-related alpha thalassemia spectrumInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- alpha thalassemia spectrumInheritance: SD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- erythrocytosis, familial, 7Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, ClinGen
- unstable hemoglobin diseaseInheritance: AD Classification: MODERATE Submitted by: ClinGen
- hemoglobin M diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Hb Bart's hydrops fetalisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hemoglobin H diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- methemoglobinemia, alpha typeInheritance: AD Classification: LIMITED Submitted by: ClinGen
- Heinz body anemiaInheritance: AR Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000558.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HBA1 | NM_000558.5 | MANE Select | c.12_33delTCCTGCCGACAAGACCAACGTC | p.Pro5ArgfsTer38 | frameshift | Exon 1 of 3 | NP_000549.1 | P69905 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HBA1 | ENST00000320868.9 | TSL:1 MANE Select | c.12_33delTCCTGCCGACAAGACCAACGTC | p.Pro5ArgfsTer38 | frameshift | Exon 1 of 3 | ENSP00000322421.5 | P69905 | |
| HBA1 | ENST00000472694.1 | TSL:1 | n.31_52delTCCTGCCGACAAGACCAACGTC | non_coding_transcript_exon | Exon 1 of 2 | ||||
| HBA1 | ENST00000487791.1 | TSL:1 | n.-20_2delTCCTGCCGACAAGACCAACGTC | non_coding_transcript_exon | Exon 1 of 2 |
Frequencies
GnomAD3 genomes Cov.: 28
GnomAD4 genome Cov.: 28
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at