16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6
The NM_000548.5(TSC2):c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,018 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_000548.5 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | NM_000548.5 | MANE Select | c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG | splice_region intron | N/A | NP_000539.2 | |||
| TSC2 | NM_001406663.1 | c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG | splice_region intron | N/A | NP_001393592.1 | ||||
| TSC2 | NM_001114382.3 | c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG | splice_region intron | N/A | NP_001107854.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | ENST00000219476.9 | TSL:5 MANE Select | c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG | splice_region intron | N/A | ENSP00000219476.3 | |||
| TSC2 | ENST00000350773.9 | TSL:1 | c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG | splice_region intron | N/A | ENSP00000344383.4 | |||
| TSC2 | ENST00000401874.7 | TSL:1 | c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG | splice_region intron | N/A | ENSP00000384468.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461018Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 726768 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Uncertain:1
Tuberous sclerosis 2 Benign:1
TSC2-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).
not provided Benign:1
See Variant Classification Assertion Criteria.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at