Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2BP6
The NM_000548.5(TSC2):c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,018 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
Verdict is Uncertain_significance. Variant got 1 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
BP6
Variant 16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G is Benign according to our data. Variant chr16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 467844.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=2, Uncertain_significance=1}.
Review Status: criteria provided, single submitter
Collection Method: curation
- -
Tuberous sclerosis 2 Benign:1
Dec 04, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely benign
Review Status: criteria provided, single submitter
Collection Method: clinical testing
- -
not provided Benign:1
Dec 19, 2023
GeneDx
Significance: Likely benign
Review Status: criteria provided, single submitter
Collection Method: clinical testing
See Variant Classification Assertion Criteria. -
TSC2-related disorder Benign:1
Oct 25, 2022
PreventionGenetics, part of Exact Sciences
Significance: Likely benign
Review Status: no assertion criteria provided
Collection Method: clinical testing
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -